ID: 1026819417

View in Genome Browser
Species Human (GRCh38)
Location 7:73536901-73536923
Sequence GTTCAAGTTCAAGTAACCTG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 131}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026819410_1026819417 15 Left 1026819410 7:73536863-73536885 CCCAGTCCTAGGGGAAAGTCCGG 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1026819412_1026819417 14 Left 1026819412 7:73536864-73536886 CCAGTCCTAGGGGAAAGTCCGGG 0: 1
1: 0
2: 1
3: 4
4: 78
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1026819404_1026819417 26 Left 1026819404 7:73536852-73536874 CCTACAGGGCCCCCAGTCCTAGG 0: 1
1: 0
2: 0
3: 19
4: 269
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1026819409_1026819417 16 Left 1026819409 7:73536862-73536884 CCCCAGTCCTAGGGGAAAGTCCG 0: 1
1: 0
2: 0
3: 9
4: 101
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1026819414_1026819417 9 Left 1026819414 7:73536869-73536891 CCTAGGGGAAAGTCCGGGAGTCT 0: 1
1: 0
2: 0
3: 11
4: 133
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1026819415_1026819417 -4 Left 1026819415 7:73536882-73536904 CCGGGAGTCTACAGTCTCCGTTC 0: 1
1: 0
2: 0
3: 6
4: 78
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131
1026819408_1026819417 17 Left 1026819408 7:73536861-73536883 CCCCCAGTCCTAGGGGAAAGTCC 0: 1
1: 0
2: 0
3: 10
4: 134
Right 1026819417 7:73536901-73536923 GTTCAAGTTCAAGTAACCTGAGG 0: 1
1: 0
2: 1
3: 12
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026819417 Original CRISPR GTTCAAGTTCAAGTAACCTG AGG Exonic