ID: 1026822430 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 7:73558249-73558271 |
| Sequence | TGCGATCATATCATAGCTGA CGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1026822430_1026822435 | 18 | Left | 1026822430 | 7:73558249-73558271 | CCGTCAGCTATGATATGATCGCA | No data | ||
| Right | 1026822435 | 7:73558290-73558312 | ACTCCAGCCTGGGCAACATATGG | 0: 31 1: 2369 2: 8072 3: 13033 4: 13184 |
||||
| 1026822430_1026822433 | 8 | Left | 1026822430 | 7:73558249-73558271 | CCGTCAGCTATGATATGATCGCA | No data | ||
| Right | 1026822433 | 7:73558280-73558302 | TAGCCACTGCACTCCAGCCTGGG | 0: 571 1: 10489 2: 175158 3: 257853 4: 193506 |
||||
| 1026822430_1026822432 | 7 | Left | 1026822430 | 7:73558249-73558271 | CCGTCAGCTATGATATGATCGCA | No data | ||
| Right | 1026822432 | 7:73558279-73558301 | ATAGCCACTGCACTCCAGCCTGG | 0: 455 1: 1748 2: 17173 3: 194844 4: 274037 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1026822430 | Original CRISPR | TGCGATCATATCATAGCTGA CGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||