ID: 1026822430

View in Genome Browser
Species Human (GRCh38)
Location 7:73558249-73558271
Sequence TGCGATCATATCATAGCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026822430_1026822435 18 Left 1026822430 7:73558249-73558271 CCGTCAGCTATGATATGATCGCA No data
Right 1026822435 7:73558290-73558312 ACTCCAGCCTGGGCAACATATGG 0: 31
1: 2369
2: 8072
3: 13033
4: 13184
1026822430_1026822433 8 Left 1026822430 7:73558249-73558271 CCGTCAGCTATGATATGATCGCA No data
Right 1026822433 7:73558280-73558302 TAGCCACTGCACTCCAGCCTGGG 0: 571
1: 10489
2: 175158
3: 257853
4: 193506
1026822430_1026822432 7 Left 1026822430 7:73558249-73558271 CCGTCAGCTATGATATGATCGCA No data
Right 1026822432 7:73558279-73558301 ATAGCCACTGCACTCCAGCCTGG 0: 455
1: 1748
2: 17173
3: 194844
4: 274037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026822430 Original CRISPR TGCGATCATATCATAGCTGA CGG (reversed) Intergenic
No off target data available for this crispr