ID: 1026822432

View in Genome Browser
Species Human (GRCh38)
Location 7:73558279-73558301
Sequence ATAGCCACTGCACTCCAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 488257
Summary {0: 455, 1: 1748, 2: 17173, 3: 194844, 4: 274037}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026822429_1026822432 24 Left 1026822429 7:73558232-73558254 CCAGGAATTTGAGGCTGCCGTCA No data
Right 1026822432 7:73558279-73558301 ATAGCCACTGCACTCCAGCCTGG 0: 455
1: 1748
2: 17173
3: 194844
4: 274037
1026822430_1026822432 7 Left 1026822430 7:73558249-73558271 CCGTCAGCTATGATATGATCGCA No data
Right 1026822432 7:73558279-73558301 ATAGCCACTGCACTCCAGCCTGG 0: 455
1: 1748
2: 17173
3: 194844
4: 274037
1026822427_1026822432 26 Left 1026822427 7:73558230-73558252 CCCCAGGAATTTGAGGCTGCCGT No data
Right 1026822432 7:73558279-73558301 ATAGCCACTGCACTCCAGCCTGG 0: 455
1: 1748
2: 17173
3: 194844
4: 274037
1026822428_1026822432 25 Left 1026822428 7:73558231-73558253 CCCAGGAATTTGAGGCTGCCGTC No data
Right 1026822432 7:73558279-73558301 ATAGCCACTGCACTCCAGCCTGG 0: 455
1: 1748
2: 17173
3: 194844
4: 274037

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026822432 Original CRISPR ATAGCCACTGCACTCCAGCC TGG Intergenic
Too many off-targets to display for this crispr