ID: 1026822433

View in Genome Browser
Species Human (GRCh38)
Location 7:73558280-73558302
Sequence TAGCCACTGCACTCCAGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 637577
Summary {0: 571, 1: 10489, 2: 175158, 3: 257853, 4: 193506}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026822430_1026822433 8 Left 1026822430 7:73558249-73558271 CCGTCAGCTATGATATGATCGCA No data
Right 1026822433 7:73558280-73558302 TAGCCACTGCACTCCAGCCTGGG 0: 571
1: 10489
2: 175158
3: 257853
4: 193506
1026822428_1026822433 26 Left 1026822428 7:73558231-73558253 CCCAGGAATTTGAGGCTGCCGTC No data
Right 1026822433 7:73558280-73558302 TAGCCACTGCACTCCAGCCTGGG 0: 571
1: 10489
2: 175158
3: 257853
4: 193506
1026822429_1026822433 25 Left 1026822429 7:73558232-73558254 CCAGGAATTTGAGGCTGCCGTCA No data
Right 1026822433 7:73558280-73558302 TAGCCACTGCACTCCAGCCTGGG 0: 571
1: 10489
2: 175158
3: 257853
4: 193506
1026822427_1026822433 27 Left 1026822427 7:73558230-73558252 CCCCAGGAATTTGAGGCTGCCGT No data
Right 1026822433 7:73558280-73558302 TAGCCACTGCACTCCAGCCTGGG 0: 571
1: 10489
2: 175158
3: 257853
4: 193506

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026822433 Original CRISPR TAGCCACTGCACTCCAGCCT GGG Intergenic
Too many off-targets to display for this crispr