ID: 1026822435

View in Genome Browser
Species Human (GRCh38)
Location 7:73558290-73558312
Sequence ACTCCAGCCTGGGCAACATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 36689
Summary {0: 31, 1: 2369, 2: 8072, 3: 13033, 4: 13184}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026822430_1026822435 18 Left 1026822430 7:73558249-73558271 CCGTCAGCTATGATATGATCGCA No data
Right 1026822435 7:73558290-73558312 ACTCCAGCCTGGGCAACATATGG 0: 31
1: 2369
2: 8072
3: 13033
4: 13184
1026822431_1026822435 -5 Left 1026822431 7:73558272-73558294 CCTGTGAATAGCCACTGCACTCC 0: 407
1: 901
2: 1029
3: 822
4: 699
Right 1026822435 7:73558290-73558312 ACTCCAGCCTGGGCAACATATGG 0: 31
1: 2369
2: 8072
3: 13033
4: 13184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026822435 Original CRISPR ACTCCAGCCTGGGCAACATA TGG Intergenic
Too many off-targets to display for this crispr