ID: 1026823013

View in Genome Browser
Species Human (GRCh38)
Location 7:73562287-73562309
Sequence CTTTGGAAGGCCAAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 274879
Summary {0: 52, 1: 2206, 2: 28156, 3: 83347, 4: 161118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026823005_1026823013 11 Left 1026823005 7:73562253-73562275 CCAGGCACAGTGGCTCACGCCTG 0: 7488
1: 42205
2: 102868
3: 132676
4: 135912
Right 1026823013 7:73562287-73562309 CTTTGGAAGGCCAAGGTGGACGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118
1026823007_1026823013 -8 Left 1026823007 7:73562272-73562294 CCTGTAATCCCAGCACTTTGGAA 0: 9594
1: 299194
2: 262940
3: 149017
4: 131705
Right 1026823013 7:73562287-73562309 CTTTGGAAGGCCAAGGTGGACGG 0: 52
1: 2206
2: 28156
3: 83347
4: 161118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026823013 Original CRISPR CTTTGGAAGGCCAAGGTGGA CGG Intergenic
Too many off-targets to display for this crispr