ID: 1026824607

View in Genome Browser
Species Human (GRCh38)
Location 7:73573659-73573681
Sequence AAACCCTAGAGAGAAACTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 262}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026824607_1026824610 5 Left 1026824607 7:73573659-73573681 CCTTTAGTTTCTCTCTAGGGTTT 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1026824610 7:73573687-73573709 CTAAGGCTCATCTGGAAGCCAGG No data
1026824607_1026824614 25 Left 1026824607 7:73573659-73573681 CCTTTAGTTTCTCTCTAGGGTTT 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1026824614 7:73573707-73573729 AGGCCAAGGTATTTCCAGGTAGG No data
1026824607_1026824609 -3 Left 1026824607 7:73573659-73573681 CCTTTAGTTTCTCTCTAGGGTTT 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1026824609 7:73573679-73573701 TTTAGAAACTAAGGCTCATCTGG No data
1026824607_1026824612 21 Left 1026824607 7:73573659-73573681 CCTTTAGTTTCTCTCTAGGGTTT 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1026824612 7:73573703-73573725 AGCCAGGCCAAGGTATTTCCAGG 0: 1
1: 0
2: 1
3: 14
4: 127
1026824607_1026824611 11 Left 1026824607 7:73573659-73573681 CCTTTAGTTTCTCTCTAGGGTTT 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1026824611 7:73573693-73573715 CTCATCTGGAAGCCAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026824607 Original CRISPR AAACCCTAGAGAGAAACTAA AGG (reversed) Intronic
902176352 1:14653782-14653804 AAACCCTGAAGAGCACCTAAGGG + Intronic
904504499 1:30939597-30939619 AGACACTAGAGAGTAACCAAAGG - Intronic
905350486 1:37342922-37342944 AACCCCTAGAGGGGAACTGAAGG + Intergenic
907080563 1:51617631-51617653 AATCCCTGGAGGGAAGCTAAGGG - Intronic
907378588 1:54065774-54065796 AAACCATAGAGGGAAAAAAAAGG + Intronic
909798776 1:79779208-79779230 AAACACTGAAAAGAAACTAAAGG - Intergenic
910149336 1:84123387-84123409 ATTCCTTATAGAGAAACTAATGG + Intronic
910697747 1:90039192-90039214 AAACCTTAAAGAGAAACAAATGG - Intergenic
911515124 1:98858891-98858913 AAAGACTAGAAAGGAACTAAAGG - Intergenic
913970365 1:143410548-143410570 GAACACAAGAGAGTAACTAATGG + Intergenic
914064740 1:144236162-144236184 GAACACAAGAGAGTAACTAATGG + Intergenic
914114410 1:144730192-144730214 GAACACAAGAGAGTAACTAATGG - Intergenic
915650883 1:157310070-157310092 AAACCCTAGAAAGAAACAGGAGG - Intergenic
916516383 1:165521392-165521414 AAACTATAGAAAGAATCTAATGG + Intergenic
916638974 1:166706204-166706226 AAACAGGAAAGAGAAACTAAAGG + Intergenic
916684155 1:167129333-167129355 AAACCCTTGAGAGTAACAAAGGG + Intergenic
916741864 1:167653250-167653272 AAACACCAGAAAGCAACTAAAGG - Intronic
917597114 1:176540062-176540084 AATTCCTAGAGAGAAGCAAATGG - Intronic
917950494 1:180027840-180027862 AAATCCTAGAGATAAGATAATGG + Intronic
919587087 1:199452091-199452113 AGACCCTAGAAATAAACAAAAGG - Intergenic
920331618 1:205212086-205212108 AAACACTAGAGAGCCACTTAGGG - Intergenic
920405300 1:205704583-205704605 AAACTCTAGACAGAAAGTCAGGG - Intergenic
921232023 1:213082709-213082731 AAAGGAGAGAGAGAAACTAAAGG + Intronic
921431727 1:215073633-215073655 AAACCACAGAGAGAAAATCATGG + Intronic
921831752 1:219734940-219734962 GAAATCTAGAGAGAAGCTAAAGG + Intronic
1063455445 10:6179383-6179405 AAAACTTCGAGAGAAAATAAAGG - Intronic
1063862319 10:10324512-10324534 AAACTTTAGATAAAAACTAAGGG + Intergenic
1066212962 10:33257816-33257838 AAAACCTAGAGAAAAAAAAAAGG - Intronic
1067336478 10:45369999-45370021 AACTCCTAGAGAGAAACATAGGG + Intergenic
1071462573 10:85912819-85912841 AATCACTAGAGATAAAATAAGGG - Intronic
1072400403 10:95092828-95092850 AAACCTGAGTGGGAAACTAAGGG + Intergenic
1073087104 10:100899539-100899561 AAAGCCTGGAGAGGATCTAAAGG - Intergenic
1073495475 10:103887099-103887121 AAAGGCTAGAAAGGAACTAAAGG + Intronic
1075080054 10:119377533-119377555 GAAGCCTAGAGAGAAATAAAAGG - Intronic
1075916359 10:126170933-126170955 GAACCCTAGAGAAGAACCAAAGG + Intronic
1076220378 10:128729048-128729070 AAGCACTTGAGAGAGACTAAAGG + Intergenic
1076537571 10:131190875-131190897 AAACCCGAGAAAGAAATAAAAGG + Intronic
1077988268 11:7377395-7377417 AAACTCTTGAGGGAAACAAAAGG - Intronic
1078375598 11:10790831-10790853 AAACTGAAGAGAGAAAGTAAAGG - Intergenic
1078490985 11:11768464-11768486 AATCCCTGTAGAGAAACTGAGGG + Intergenic
1078637290 11:13063817-13063839 AAAGCCTAGAGGGAAACACATGG + Intergenic
1080220397 11:29896320-29896342 AAACCCCTGAGCAAAACTAAAGG + Intergenic
1082183427 11:49148037-49148059 AATCCCTAGAAAGAAAGTTAGGG + Intronic
1082735478 11:56851017-56851039 AAACACTGGACAGATACTAAAGG + Intergenic
1082817215 11:57516974-57516996 CAAGCCAAGAGAGGAACTAATGG + Intergenic
1085873319 11:80376313-80376335 AAACGCTATGCAGAAACTAAAGG - Intergenic
1086682937 11:89697304-89697326 AATCCCTAGAAAGAAAGTTAGGG - Intergenic
1086974936 11:93120903-93120925 CCACCCAAGAGAGAAACAAATGG + Intergenic
1087236918 11:95730084-95730106 AAACCTTAAGCAGAAACTAATGG - Intergenic
1089374843 11:117986812-117986834 AAAACCTAGAGCTAAACTTACGG - Intronic
1092086407 12:5766532-5766554 CAACCCTAGGGAGGCACTAATGG + Intronic
1092145789 12:6213803-6213825 AAACCCAAGGGAGAAGCTACGGG + Intronic
1093490356 12:19698347-19698369 AAATCCTAGAGAGATCCTGAAGG - Intronic
1094044388 12:26151286-26151308 AGAGGCTAGAGAGAAACTGAAGG + Intronic
1094228202 12:28071059-28071081 AAACTCTTTAGAGAAATTAAAGG + Intergenic
1094282016 12:28750619-28750641 CAACCCTTGAGAGAAACTCATGG + Intergenic
1095775180 12:46002690-46002712 AAAACCAAGAGAAAAACAAATGG + Intergenic
1095783099 12:46082348-46082370 ACATCCTAGAGAGAATTTAATGG - Intergenic
1096478205 12:51921381-51921403 AATCCACAGAGAGAAACTGATGG - Intronic
1096735719 12:53652319-53652341 AAACTAAAGAGAGAAATTAAAGG - Intronic
1097609752 12:61805971-61805993 AAAACACAGAGAGAAAATAATGG + Intronic
1098520235 12:71427326-71427348 AAAACCTAGAGAGAGAAGAAAGG - Intronic
1099817550 12:87668519-87668541 AATGCCTAGAGAGCATCTAAAGG - Intergenic
1105209093 13:18247433-18247455 AAGCCCTAAAGAGAAACCAAAGG + Intergenic
1108152732 13:47553220-47553242 AAGCCCCAGGGAGAAACTGAAGG - Intergenic
1108160075 13:47630019-47630041 AGTCCCTGGAGAGAAACTTATGG + Intergenic
1109623742 13:64946163-64946185 AAACCCTAAAGAAAAGCAAAAGG + Intergenic
1109827117 13:67736396-67736418 AAACCCTTAAGTGAAAATAAAGG + Intergenic
1111417659 13:87970056-87970078 TAAGCCTAGGGAAAAACTAAGGG + Intergenic
1111726675 13:92018865-92018887 AAACCCAACACAAAAACTAAAGG + Intronic
1111759579 13:92444774-92444796 AAACCATTGAAAGAAACTAGAGG + Intronic
1111854193 13:93615765-93615787 AAAGCTTAGAGAGAAAGTGAGGG - Intronic
1112915779 13:104548982-104549004 AAACCCTAAAGACAGACTAAAGG - Intergenic
1112937090 13:104814370-104814392 AAACCCTTTAGAGAAAGTAAAGG + Intergenic
1116657687 14:47673395-47673417 AAACCCCTGAGTGAAACCAAGGG + Intronic
1117170701 14:53092131-53092153 AAACCATAAAGAGAAAGAAATGG + Intronic
1119102510 14:71893358-71893380 AAATCCTAGAGAGAAGGTAATGG - Intergenic
1120138272 14:80897336-80897358 AATACCAAGAGAGAAACTATAGG - Intronic
1120160540 14:81140590-81140612 AAAGCCTGGAGAGAAAATGAAGG - Intronic
1120776211 14:88440382-88440404 AAAACTTAAAGGGAAACTAAAGG - Intronic
1120932663 14:89864997-89865019 CAACCTTAGAGAGAAGCCAAGGG + Intronic
1121748582 14:96324854-96324876 AAAACCGAGAGAGAAAAGAAGGG + Intronic
1123013150 14:105358859-105358881 CACTCATAGAGAGAAACTAAAGG - Intronic
1123738795 15:23213170-23213192 AGACACTAGGGAAAAACTAAAGG - Intergenic
1124021719 15:25931507-25931529 AAACCCTCCAGGGAAATTAAGGG - Intergenic
1124290005 15:28441804-28441826 AGACACTAGGGAAAAACTAAAGG - Intergenic
1124293224 15:28475485-28475507 AGACACTAGGGAAAAACTAAAGG + Intergenic
1125020503 15:34980826-34980848 AAAAACTACAGAGACACTAAAGG - Exonic
1125044134 15:35226939-35226961 AAAGCCCAGACAGAACCTAATGG - Intronic
1125167854 15:36729810-36729832 GAAACCTAGAGACAGACTAATGG - Intronic
1127174757 15:56341601-56341623 AAACCCTAAAAAGAAAGAAAGGG + Intronic
1129511318 15:76125183-76125205 AAACCCTAGAGGAAAACATATGG + Intronic
1131437855 15:92437573-92437595 AAACACTAGAGAGCAACTAGAGG + Intronic
1131990158 15:98085329-98085351 GATGCCTAGAGAGAAAATAAAGG - Intergenic
1132132247 15:99293076-99293098 GAACCCTAGAGAAAAGCCAATGG - Intronic
1135421107 16:22306097-22306119 AAACCATAAACAGAAAATAAGGG - Intronic
1136708729 16:32215141-32215163 AGACACTAGGGAAAAACTAAAGG + Intergenic
1136759177 16:32714267-32714289 AGACACTAGGGAAAAACTAAAGG - Intergenic
1136808930 16:33156119-33156141 AGACACTAGGGAAAAACTAAAGG + Intergenic
1136815406 16:33266199-33266221 AGACACTAGGGAAAAACTAAAGG + Intronic
1136903807 16:34067646-34067668 AAACTCTCGAAAGAAAGTAATGG + Intergenic
1136904385 16:34073463-34073485 AAACTCTCGAAAGAAAGTAATGG + Intergenic
1138819522 16:60242478-60242500 AAACCTAAGAGAATAACTAAAGG - Intergenic
1139501017 16:67365637-67365659 AACCAGTAGAGAGAAACAAATGG - Intronic
1140035784 16:71370299-71370321 AAACGCAACAGAGAAAATAAAGG - Intronic
1203061335 16_KI270728v1_random:974578-974600 AGACACTAGGGAAAAACTAAAGG - Intergenic
1147551393 17:41445039-41445061 AAATCCTACAGAGAAACCAAAGG + Intergenic
1149776746 17:59364237-59364259 AAGGCCCAGAGAGAAACTGAGGG + Intronic
1151084650 17:71366378-71366400 AAACACTAGGGTGAAACAAATGG - Intergenic
1152991073 18:364327-364349 AAACCACAAAGAGAAAATAATGG - Intronic
1153145203 18:2023857-2023879 CAACCTTAGAGAGAAGCTATCGG + Intergenic
1153403652 18:4709894-4709916 AAATCCTAGAGAAAAACTATTGG - Intergenic
1155140528 18:23040204-23040226 AGGCACTAGAGAGAAATTAAGGG + Intergenic
1158375240 18:56856071-56856093 AAATCCTAGAAGGAAACTAGAGG + Intronic
1159808910 18:72992686-72992708 CAAGCCTAGAAAGAAACTCAGGG + Intergenic
1160605655 18:80047778-80047800 AAACCCTAGAGATAAACATTTGG - Intronic
1163286475 19:16351624-16351646 AAACCCCAGAGTGAATCTGAAGG - Intergenic
1164472772 19:28549964-28549986 AAGCACTAGAGACAAACAAAGGG - Intergenic
1167964350 19:53131610-53131632 GAATCCTAGGGAGAAAATAAAGG - Intronic
926164302 2:10509382-10509404 ACATCCCTGAGAGAAACTAAAGG + Intergenic
926192299 2:10738023-10738045 AAGCGCTAGAGAGGAACAAAGGG - Intronic
926843921 2:17112832-17112854 AAACTCTAGAAAGAAACCAAAGG - Intergenic
927289483 2:21391825-21391847 AAACACTGAAGACAAACTAATGG - Intergenic
929072274 2:38044735-38044757 AAACCCTAAAAAGAATCAAAAGG - Intronic
929293800 2:40223612-40223634 AAAACCTAGGGAGAAAGAAAAGG - Intronic
929963714 2:46517375-46517397 AATTCCTAGAAAGAAACAAACGG + Intronic
931068349 2:58613630-58613652 AAACCATAGAGAGAAACATCAGG - Intergenic
931702721 2:64922305-64922327 CATCCCTAGGGAGAATCTAATGG - Intergenic
931805937 2:65804125-65804147 AAACCATATGAAGAAACTAAAGG + Intergenic
932039985 2:68289422-68289444 AATGCCAAGAGAAAAACTAAAGG - Intronic
934020184 2:87941891-87941913 ATGCCTTAGAGTGAAACTAATGG - Intergenic
937155645 2:119717029-119717051 TAACCATAAAGAGAAACTGACGG - Intergenic
941017033 2:160369253-160369275 AGCCCCTAGAGAAAAACTAGTGG - Intronic
941178905 2:162235042-162235064 AAAGCCTGGCGAGAAACTGAGGG - Intronic
942930191 2:181482437-181482459 AAAGCCCACAGAGATACTAAAGG - Intronic
944610351 2:201398214-201398236 CAACCCTTGAGATAAGCTAAAGG + Exonic
945703942 2:213205520-213205542 AAAGCCTAGAAACAAAATAATGG + Intergenic
945776354 2:214111229-214111251 AAACCCTAGAGGAAAACCTAGGG - Intronic
946626490 2:221617339-221617361 AAAATCTAGAGGGTAACTAAAGG + Intergenic
946993887 2:225368782-225368804 AAACAATAGAGAGGAAATAAGGG - Intergenic
946993890 2:225368806-225368828 AAACAATAGAGAGGAAATAAGGG - Intergenic
947281223 2:228457562-228457584 AAAAATTAGAGAGAAACTGAAGG - Intergenic
947879648 2:233496183-233496205 GAACCCAAAAGAGAAACAAATGG - Intronic
948666596 2:239538630-239538652 AAACCCTAGAGAGAAGCAATGGG + Intergenic
1169978361 20:11355798-11355820 AAAACCTAGAGAGAGATTATAGG + Intergenic
1171290265 20:23979147-23979169 AAGCCCTGAAGAGAAACCAAAGG + Intergenic
1172316618 20:33960216-33960238 AAGAACTGGAGAGAAACTAAAGG - Intergenic
1173913744 20:46690299-46690321 AAATTCTGGAAAGAAACTAACGG - Intergenic
1174272407 20:49379276-49379298 AAATCATACAGAGAAACAAAGGG - Intronic
1174974215 20:55312837-55312859 AAACCTTAGAGGAAAACTAAGGG + Intergenic
1175405908 20:58727987-58728009 AGACCTTAGAAGGAAACTAAAGG + Intergenic
1176763324 21:12984083-12984105 AAAATCTAGAGAGAAACAATCGG - Intergenic
1176892528 21:14335442-14335464 GGAACCTAAAGAGAAACTAACGG + Intergenic
1177536593 21:22436219-22436241 AAACACTAGTGATAAAATAAAGG + Intergenic
1177762958 21:25422720-25422742 AAAACTTAGAGAGAAGCAAAGGG - Intergenic
1177929447 21:27262693-27262715 GAACCCTACAGAGACAATAAAGG - Intergenic
1180767163 22:18351865-18351887 AAGCCCTGAAGAGAAACCAAAGG - Intergenic
1180779147 22:18510514-18510536 AAGCCCTGAAGAGAAACCAAAGG + Intergenic
1180811867 22:18767834-18767856 AAGCCCTGAAGAGAAACCAAAGG + Intergenic
1180897291 22:19345997-19346019 AAACCATTGAGAAAAACAAATGG + Intronic
1181198021 22:21202076-21202098 AAGCCCTGAAGAGAAACCAAAGG + Intergenic
1181401724 22:22653729-22653751 AAGCCCTGAAGAGAAACCAAAGG - Intergenic
1181703681 22:24634823-24634845 AATCCCTGAAGAGAAACCAAAGG - Intergenic
1184204605 22:42994155-42994177 AAGCCCTAGAGGGAAACTTTGGG + Intronic
1203228784 22_KI270731v1_random:92759-92781 AAGCCCTGAAGAGAAACCAAAGG - Intergenic
949355409 3:3175643-3175665 AAAGACTAGATAAAAACTAAGGG - Intronic
949637103 3:5995089-5995111 AAAACGTAGAGAAAAATTAAGGG - Intergenic
950320477 3:12048043-12048065 AAACCCTAGAAACAAACAATGGG - Intronic
950901732 3:16504086-16504108 AAAATGTACAGAGAAACTAAGGG - Intronic
951162632 3:19443871-19443893 AAACATTAGTGAGAAAATAATGG + Intronic
951554408 3:23906176-23906198 AAACCAAAGGGAGAAACAAAGGG + Intronic
952174547 3:30847418-30847440 AAACCCTTAAAAGAAAATAAGGG + Intronic
953183048 3:40614393-40614415 AAACCCTACAGAGAAAGTTCAGG + Intergenic
954583029 3:51713398-51713420 AAACAGTAGAGTGAAAGTAAAGG + Intronic
956544662 3:70387269-70387291 AAACCCTAGAAATAATCTATTGG + Intergenic
957023395 3:75150579-75150601 GAACCATAGAGAGGAATTAAAGG + Intergenic
957186564 3:76949238-76949260 AAACACATGAGAGAAACAAAAGG - Intronic
957439945 3:80232649-80232671 AAATTATACAGAGAAACTAAAGG - Intergenic
957764552 3:84605571-84605593 CAACCCTAGAGATAAACACAGGG - Intergenic
958172085 3:89950325-89950347 AAACTTTAAAGAGAAACTACAGG + Intergenic
959091372 3:101906536-101906558 AAACCCTAGAAGAAAACTTAGGG - Intergenic
963488422 3:145967139-145967161 AATTCCTAGAGAGGTACTAAGGG + Intergenic
964581076 3:158238759-158238781 AAACCCTAGAAAAAAACAGAGGG + Intronic
964582435 3:158255163-158255185 AAACCCTAGAAAAAAACAGAGGG - Intronic
964864185 3:161236666-161236688 AAACACTTGAAAGAAACTATAGG - Intronic
971308086 4:25501276-25501298 AGACCCTAGAGATCACCTAATGG + Intergenic
973147765 4:46849210-46849232 AAAACCTGGGGAGAAACTGATGG - Intronic
973701248 4:53539348-53539370 ATACAATAAAGAGAAACTAAAGG - Intronic
973985154 4:56344345-56344367 AAACTCTTGAGATAAACAAATGG - Intronic
975587708 4:75967129-75967151 AAACTCTAGAAAGAAAACAAGGG + Intronic
976466922 4:85380787-85380809 AAACCCTAGAATGAAACCTAGGG + Intergenic
977577978 4:98694900-98694922 AAATTCTAGAGAGAAGCTGATGG + Intergenic
979032692 4:115670793-115670815 ATAAACTAGAGACAAACTAAAGG + Intergenic
981280474 4:142952862-142952884 AAAACATACAGAGAAACTGAGGG + Intergenic
982530119 4:156529948-156529970 AAACCAAAGACAGAAACCAAGGG - Intergenic
982695659 4:158596792-158596814 AAGTCCAAGAGAGAAAATAATGG + Intronic
983133931 4:164056433-164056455 GAACCCAAGTGAGAATCTAAAGG - Intronic
983533870 4:168837034-168837056 AAGCCCTGGAGGGAAAATAAAGG + Intronic
983994186 4:174160801-174160823 AAACACTAGAGACAAATAAAAGG - Intergenic
984190255 4:176596874-176596896 AAGAACTAGAGAGAAACAAATGG - Intergenic
984610143 4:181828321-181828343 AAACCCCAGAGAAAAGCAAAGGG - Intergenic
987803601 5:22731979-22732001 GAAACCCTGAGAGAAACTAAGGG + Intronic
989406405 5:41065925-41065947 AAACCATAGTGAGAAACTCTTGG + Intronic
990303891 5:54476196-54476218 AAATGCTAGAGAGAAAATGAAGG - Intergenic
992496639 5:77300424-77300446 AAACCCTAGAGAGTATGAAAGGG - Intronic
994200900 5:96974590-96974612 AAAACATAGGGATAAACTAAAGG - Intronic
994327532 5:98466044-98466066 AAATCCTGGAGAGAATCTACAGG + Intergenic
995661202 5:114485182-114485204 AAACCCTAGGTAAAAACCAATGG - Intronic
996914396 5:128694871-128694893 AAACAGAAGAGAAAAACTAAGGG - Intronic
998230422 5:140358088-140358110 TGACCCAAGAGAGAAACTTAGGG + Intergenic
999539500 5:152556249-152556271 AAACCCTTGAGAGAACTCAAAGG - Intergenic
1000799596 5:165708530-165708552 AAACACAAGAAAGAACCTAAAGG + Intergenic
1002057786 5:176608761-176608783 AAATCCTAGAGGGAAAGGAATGG - Intronic
1003975713 6:11341998-11342020 GAACCCTAAAAAGAAACAAATGG + Intronic
1004271814 6:14202528-14202550 AAACCCTGGAAAGAAACCAGAGG - Intergenic
1005114960 6:22325779-22325801 AAACATTTGAGAGAAACTCATGG - Intergenic
1005704709 6:28439968-28439990 AAATGCTATAGAGAAAATAAAGG + Intronic
1006347603 6:33495685-33495707 AACCAGTAGAGAGAAAATAAGGG - Intergenic
1006591596 6:35162016-35162038 AAACCCAAGAGAGAGAAGAAAGG + Intergenic
1007003929 6:38342152-38342174 AAGGCCTAGAGAATAACTAAAGG + Intronic
1007489551 6:42208481-42208503 AAACCCTATAGAAAGACTAGGGG - Intronic
1008606364 6:53143868-53143890 AAAGCATAAAGAGAAACAAAAGG + Intronic
1008665441 6:53711205-53711227 AGAGCATAGAGAGAAACTGAGGG + Intergenic
1008812151 6:55515767-55515789 AAACCCAAGAGAAAAATAAATGG + Intronic
1011007760 6:82666817-82666839 AGAACCAAGAAAGAAACTAATGG - Intergenic
1011016223 6:82758883-82758905 AAACCCTAGAAGGAAACCTAGGG + Intergenic
1011486641 6:87849105-87849127 AAACCAAAGAGACAAACAAATGG - Intergenic
1015989225 6:138918872-138918894 AAACTCTAGAGACAATCTGAAGG + Intronic
1017044559 6:150334880-150334902 AAACCCAGGAGAGAAATTAGAGG + Intergenic
1017363714 6:153606918-153606940 AAACCATAAAAAGAAACAAATGG + Intergenic
1017611125 6:156187528-156187550 ATACCCTCGTAAGAAACTAAGGG + Intergenic
1018330168 6:162718994-162719016 AAACTCTAGAGAGGGACAAAAGG + Intronic
1021976026 7:26011976-26011998 AAACTGGAGAGAGACACTAAAGG - Intergenic
1022586062 7:31613321-31613343 AAACCCTAGAAATTAACCAAAGG - Intronic
1022669391 7:32441498-32441520 CAAACCTAGTGAGAAACCAAAGG + Intergenic
1022895108 7:34742096-34742118 AAATCCTTGAGAAAAACTTATGG - Intronic
1026824607 7:73573659-73573681 AAACCCTAGAGAGAAACTAAAGG - Intronic
1027362736 7:77426343-77426365 AAACACAAGAGGGAAACTAATGG - Intergenic
1030712064 7:112760855-112760877 AAATACTAGATAGAGACTAATGG + Intergenic
1032943058 7:136817732-136817754 AAACAATTGAGAGAAATTAAGGG + Intergenic
1033776808 7:144620447-144620469 ATACCCTAAAGAAAAAATAAAGG + Intronic
1033940502 7:146646948-146646970 ACACCCTGGAGAGAAACAATGGG + Intronic
1036423512 8:8620381-8620403 AATGCTTAGAGAGAAACTTATGG + Intergenic
1036930998 8:12955433-12955455 GACCCCTAGAGAGAAAAGAAGGG - Intronic
1037038007 8:14191710-14191732 AAAGAGAAGAGAGAAACTAAGGG + Intronic
1039578879 8:38647758-38647780 AGACCCTGGAGAGGAACTGAGGG - Intergenic
1039741811 8:40389768-40389790 ACATCCAAGAGAGAAACTGAGGG - Intergenic
1040112878 8:43579071-43579093 AAAAACTAGAAAGAAACTATTGG + Intergenic
1041633200 8:60111781-60111803 AAAGCACTGAGAGAAACTAATGG - Intergenic
1042407346 8:68421454-68421476 AAACCCTAGAAAAAACCTAGTGG + Intronic
1042513982 8:69640699-69640721 AAATCCTAGAAAGAAACACATGG - Intronic
1045021737 8:98050672-98050694 AAAACCTAAAGAAAAAGTAAAGG - Intergenic
1046034924 8:108829310-108829332 GAACCCTAGATAGAAACTTAGGG + Intergenic
1046666899 8:117014223-117014245 AAACCCCAGTGAGTTACTAATGG - Intronic
1048050589 8:130812276-130812298 AAACCCTAGACAGAGCCTAATGG - Intronic
1048643229 8:136387869-136387891 AGACGCTAGAGGGAAACTACAGG + Intergenic
1050997287 9:12236369-12236391 AGAACCTAGAGAGAAAAAAAAGG + Intergenic
1051364190 9:16309452-16309474 AAACCCTGGGAAGAAATTAAGGG + Intergenic
1051969809 9:22874917-22874939 ATATCTAAGAGAGAAACTAATGG - Intergenic
1052445012 9:28549106-28549128 AACCTGTAGAGAGAAAATAATGG - Intronic
1053228880 9:36388120-36388142 AAACCATACAGAAAAACAAAAGG + Intronic
1055531534 9:77189209-77189231 AAACCCTAGAAGAAAACTTAGGG - Intronic
1056048332 9:82742135-82742157 AACCCCTACAGATATACTAATGG - Intergenic
1056238555 9:84620367-84620389 GAACCCTGGATAGAAACTAAGGG + Intergenic
1058966248 9:110041642-110041664 AGACCCTGGAGAGGAAATAAAGG + Intronic
1059583706 9:115581946-115581968 CAGCCCTAGACAGAAAATAAAGG - Intergenic
1059874942 9:118624061-118624083 AAACTCTAGACAAAAACTAAAGG - Intergenic
1060974767 9:127758399-127758421 AAACCCTAAAAATAAACTAAAGG + Intronic
1186225721 X:7396823-7396845 AAGTCCTAAAGAGAAACAAAGGG - Intergenic
1186714497 X:12236071-12236093 AAACCACAGAGAGAATCTGATGG - Intronic
1188615989 X:32159748-32159770 AAGAGCGAGAGAGAAACTAAGGG + Intronic
1189358447 X:40329212-40329234 AAGCGCTAGAGAGAGACTCAAGG - Intergenic
1190221205 X:48513472-48513494 AAACCCTATAGTCAAACTAGAGG - Intronic
1191794827 X:65010150-65010172 AAGACCAAAAGAGAAACTAAAGG - Intronic
1191944007 X:66510778-66510800 AAGCCCTGGACAGAAACTATGGG + Intergenic
1196391940 X:115216853-115216875 AAACCCTTAAGAAAAAGTAAAGG + Intronic
1197780562 X:130155301-130155323 AAGGCCAAGAGAGAAACAAAAGG + Intronic
1198055306 X:132988615-132988637 AAAACCTAGAAGGAAACTAAAGG + Intergenic
1198707518 X:139464568-139464590 CAACCCTAGAGGGACAGTAAAGG - Intergenic
1198980048 X:142385230-142385252 AAACTCTAGAGAAGAAATAAAGG + Intergenic
1199124339 X:144097237-144097259 ATGCCTTAGAGTGAAACTAATGG + Intergenic
1201134547 Y:10980616-10980638 ATACTCTCGAAAGAAACTAATGG - Intergenic
1201138433 Y:11008308-11008330 ATACCCTAGAAAGAAAGGAATGG - Intergenic