ID: 1026824611

View in Genome Browser
Species Human (GRCh38)
Location 7:73573693-73573715
Sequence CTCATCTGGAAGCCAGGCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026824607_1026824611 11 Left 1026824607 7:73573659-73573681 CCTTTAGTTTCTCTCTAGGGTTT 0: 1
1: 0
2: 0
3: 20
4: 262
Right 1026824611 7:73573693-73573715 CTCATCTGGAAGCCAGGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026824611 Original CRISPR CTCATCTGGAAGCCAGGCCA AGG Intronic
No off target data available for this crispr