ID: 1026826835

View in Genome Browser
Species Human (GRCh38)
Location 7:73587725-73587747
Sequence CTGGACTCCCAGGGAAAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026826825_1026826835 27 Left 1026826825 7:73587675-73587697 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG No data
1026826829_1026826835 -4 Left 1026826829 7:73587706-73587728 CCGAGCCTGGCCGAGAATTCTGG No data
Right 1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG No data
1026826826_1026826835 26 Left 1026826826 7:73587676-73587698 CCAAAGTGCTGGGATTACAGGCA 0: 89533
1: 228199
2: 240322
3: 214910
4: 187714
Right 1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG No data
1026826828_1026826835 -1 Left 1026826828 7:73587703-73587725 CCACCGAGCCTGGCCGAGAATTC No data
Right 1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG No data
1026826831_1026826835 -9 Left 1026826831 7:73587711-73587733 CCTGGCCGAGAATTCTGGACTCC No data
Right 1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG No data
1026826823_1026826835 30 Left 1026826823 7:73587672-73587694 CCTCCCAAAGTGCTGGGATTACA 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
Right 1026826835 7:73587725-73587747 CTGGACTCCCAGGGAAAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026826835 Original CRISPR CTGGACTCCCAGGGAAAGAG TGG Intergenic
No off target data available for this crispr