ID: 1026829351

View in Genome Browser
Species Human (GRCh38)
Location 7:73601498-73601520
Sequence CCCAGAGAGAATGCCAGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026829342_1026829351 11 Left 1026829342 7:73601464-73601486 CCTTTCCCTGATCTGCTGGTACA 0: 1
1: 0
2: 3
3: 12
4: 178
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829335_1026829351 29 Left 1026829335 7:73601446-73601468 CCCATCCCCTGGTGGCTCCCTTT 0: 1
1: 0
2: 1
3: 17
4: 278
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829339_1026829351 22 Left 1026829339 7:73601453-73601475 CCTGGTGGCTCCCTTTCCCTGAT 0: 1
1: 1
2: 1
3: 22
4: 212
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829338_1026829351 23 Left 1026829338 7:73601452-73601474 CCCTGGTGGCTCCCTTTCCCTGA 0: 1
1: 1
2: 1
3: 31
4: 294
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829337_1026829351 24 Left 1026829337 7:73601451-73601473 CCCCTGGTGGCTCCCTTTCCCTG 0: 1
1: 1
2: 3
3: 30
4: 350
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829341_1026829351 12 Left 1026829341 7:73601463-73601485 CCCTTTCCCTGATCTGCTGGTAC 0: 1
1: 0
2: 0
3: 13
4: 213
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829343_1026829351 6 Left 1026829343 7:73601469-73601491 CCCTGATCTGCTGGTACAGAAAG 0: 1
1: 0
2: 1
3: 17
4: 145
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829336_1026829351 28 Left 1026829336 7:73601447-73601469 CCATCCCCTGGTGGCTCCCTTTC 0: 1
1: 0
2: 3
3: 31
4: 453
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data
1026829344_1026829351 5 Left 1026829344 7:73601470-73601492 CCTGATCTGCTGGTACAGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 123
Right 1026829351 7:73601498-73601520 CCCAGAGAGAATGCCAGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026829351 Original CRISPR CCCAGAGAGAATGCCAGGGT GGG Intronic
No off target data available for this crispr