ID: 1026829604

View in Genome Browser
Species Human (GRCh38)
Location 7:73602857-73602879
Sequence ACTCCCTGGGTCCCGGGCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026829594_1026829604 -2 Left 1026829594 7:73602836-73602858 CCCTGCTCACAGCTGCTGCCCAC 0: 1
1: 0
2: 7
3: 49
4: 437
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829588_1026829604 26 Left 1026829588 7:73602808-73602830 CCCAGGCCGCTGAGGGCCTAGGG No data
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829593_1026829604 1 Left 1026829593 7:73602833-73602855 CCTCCCTGCTCACAGCTGCTGCC No data
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829586_1026829604 27 Left 1026829586 7:73602807-73602829 CCCCAGGCCGCTGAGGGCCTAGG 0: 1
1: 0
2: 0
3: 8
4: 246
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829595_1026829604 -3 Left 1026829595 7:73602837-73602859 CCTGCTCACAGCTGCTGCCCACT 0: 1
1: 0
2: 3
3: 53
4: 378
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829592_1026829604 10 Left 1026829592 7:73602824-73602846 CCTAGGGCTCCTCCCTGCTCACA 0: 1
1: 0
2: 7
3: 46
4: 566
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829590_1026829604 25 Left 1026829590 7:73602809-73602831 CCAGGCCGCTGAGGGCCTAGGGC No data
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data
1026829591_1026829604 20 Left 1026829591 7:73602814-73602836 CCGCTGAGGGCCTAGGGCTCCTC No data
Right 1026829604 7:73602857-73602879 ACTCCCTGGGTCCCGGGCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026829604 Original CRISPR ACTCCCTGGGTCCCGGGCAG GGG Intronic