ID: 1026830423

View in Genome Browser
Species Human (GRCh38)
Location 7:73607058-73607080
Sequence GGGGGGAAAGTGATGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1346
Summary {0: 1, 1: 0, 2: 5, 3: 126, 4: 1214}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026830423_1026830432 25 Left 1026830423 7:73607058-73607080 CCATCCTCCATCACTTTCCCCCC 0: 1
1: 0
2: 5
3: 126
4: 1214
Right 1026830432 7:73607106-73607128 GAGATCCCCCATTTCCCATCAGG 0: 1
1: 0
2: 1
3: 10
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026830423 Original CRISPR GGGGGGAAAGTGATGGAGGA TGG (reversed) Intronic
900088259 1:908750-908772 GGAGGGGAAGGGATGGGGGAGGG + Intergenic
900166196 1:1245160-1245182 GGGTGAAAAGTGGGGGAGGAGGG - Intronic
900293917 1:1939229-1939251 GGGGGGAGAGAGAGGGAGGATGG + Intronic
900361585 1:2291635-2291657 GGGGGGAAGGTGCTGGAAGGAGG - Intronic
900791519 1:4684002-4684024 GGGAGGAAGGAGATGGAGGAAGG + Intronic
900966363 1:5961628-5961650 TGGGGGACAGTGGAGGAGGATGG - Intronic
901040684 1:6361309-6361331 GGGGGGCAGGGGCTGGAGGAGGG + Intronic
901131053 1:6962734-6962756 GGACGAAAAGGGATGGAGGATGG - Intronic
901192628 1:7421730-7421752 GGTGGGTCCGTGATGGAGGATGG + Intronic
901500018 1:9646548-9646570 GGGAGAAAAGGAATGGAGGAAGG + Intergenic
901690518 1:10970119-10970141 GGTGGGGAAGGGAGGGAGGAAGG + Intronic
901868259 1:12122062-12122084 GGGGGCAGAGTGAGTGAGGAGGG + Intronic
902111258 1:14080371-14080393 CGGGGGAAACTAATGGAGTAAGG + Intergenic
902114140 1:14107062-14107084 GAGGGGAGAGAGATGAAGGAAGG - Intergenic
902411244 1:16212661-16212683 GAGGGGGAGGTGAAGGAGGAGGG + Intergenic
902528779 1:17076993-17077015 GGGAGGGAAGCGAGGGAGGAGGG - Intronic
902655661 1:17866239-17866261 AAGGGGAAAATGATGGGGGAGGG - Intergenic
902839453 1:19066017-19066039 GGGTGGAAAGTGGTTGAGGTTGG - Intergenic
903377414 1:22875619-22875641 AGGGAGAAAGTGAGGAAGGAAGG - Intronic
903938734 1:26914104-26914126 GGTGGGGAAGTGGTGGGGGAGGG + Intronic
904128704 1:28260151-28260173 AGGGGGAGAGGGAGGGAGGAGGG - Intronic
904295193 1:29515737-29515759 GGGGAGGAAGTGGAGGAGGATGG - Intergenic
904302421 1:29562871-29562893 GGGGAGAGAGTGATGGATGGAGG + Intergenic
904333957 1:29785046-29785068 GGGGAGACAGAGAAGGAGGAGGG + Intergenic
904533907 1:31186683-31186705 GGGAGGAAAGTGATGGAGTGAGG - Intronic
904598877 1:31663037-31663059 GGGGGGAAAGGTAGGGAGGTAGG - Intronic
904599281 1:31664887-31664909 GGGGGGAAAGGCAGGGAGGTAGG - Intronic
904618669 1:31763096-31763118 GGGAGGATAGGGATGGGGGATGG + Intronic
904653653 1:32025734-32025756 GGGGAGAAAGGGAGGAAGGAAGG - Intronic
904811454 1:33165669-33165691 GGGAGGCAAGTGTTGGAGGTTGG - Intronic
904840790 1:33370643-33370665 GGGGAGAAAGAAATGGATGAGGG - Intronic
905242675 1:36590971-36590993 CTGGGGAAGGGGATGGAGGAAGG + Intergenic
905405635 1:37730532-37730554 GGGAGGGAAGTAAAGGAGGAGGG + Intronic
905473766 1:38211674-38211696 GTGGGGGAGGTGATGGGGGATGG - Intergenic
905789178 1:40781357-40781379 GGTGGGAGAGGGAAGGAGGAGGG + Intergenic
905824109 1:41016295-41016317 GGGGCCAAACTGAGGGAGGAAGG + Intronic
905851004 1:41274987-41275009 GGGGAGAAAATGAGGAAGGAGGG - Intergenic
905875218 1:41427881-41427903 GCGGGGAGAGAGAGGGAGGAGGG - Intergenic
905898804 1:41567128-41567150 GGGTGAGAAGGGATGGAGGAGGG - Intronic
905942930 1:41878720-41878742 GGGGGGAAGGAGAGGAAGGAAGG - Intronic
905943888 1:41885710-41885732 GAGGGGGAAGGGAAGGAGGAAGG - Intronic
906127207 1:43434261-43434283 GGAGAGAAAGTCATGGAGGTGGG - Intronic
906581877 1:46941530-46941552 GTGGGGAGAGTGAAGGAGGAGGG + Intergenic
906601839 1:47137367-47137389 GTGGGGAGAGTGAAGGGGGAGGG - Intergenic
906764803 1:48418856-48418878 GAGGGGAAGGAGAGGGAGGAAGG + Intronic
906843577 1:49165775-49165797 GGAGGGAAGGGGATGGAGGAAGG + Intronic
906951209 1:50335649-50335671 GGGGAGAAAAAGATGGAGGAGGG + Intergenic
907019722 1:51055142-51055164 GGGGAGAGAGGGAGGGAGGAAGG - Intergenic
907170175 1:52455666-52455688 GGGGGGAGAGGGAAGGAGGAAGG + Intronic
907505888 1:54918074-54918096 GAGGAGAGAGAGATGGAGGAGGG - Intergenic
907719754 1:56960718-56960740 GGATAGAAAGTGATGGTGGATGG + Intronic
908558183 1:65278964-65278986 ATGGGGAAGGGGATGGAGGAGGG - Intronic
909026944 1:70493320-70493342 GGTGGGGAAGTGAAGGAGGAAGG - Intergenic
909183690 1:72457785-72457807 GAGGGGAGAGGGAGGGAGGAAGG - Intergenic
909480583 1:76125468-76125490 GAGGGGAGAGAGGTGGAGGAGGG - Intronic
909738755 1:79001176-79001198 GGGGGGGGAGGGAGGGAGGAAGG + Intronic
910371103 1:86515965-86515987 GGGGGGAAAGTGCAGGGTGAGGG + Intergenic
911750116 1:101487098-101487120 GGGGGGAGGGTGCTGGCGGAAGG - Intergenic
912511051 1:110190379-110190401 GAGGGGAAAGAGGTGGGGGATGG - Intronic
912719888 1:112011341-112011363 GGGAGGACAGTGAAGGAGGTGGG - Intergenic
913242631 1:116842840-116842862 GGAGGGAAATTGCAGGAGGAAGG + Intergenic
913369505 1:118082828-118082850 TGGGGGAAAGTGACTGAGGAAGG + Intronic
913556473 1:119972107-119972129 GGTGAGAAAGGGAGGGAGGAAGG + Intronic
914394728 1:147254399-147254421 TGGGAGGAAGTGAGGGAGGAAGG + Intronic
914676248 1:149909447-149909469 GGGGGGCAGGTAATGGTGGACGG - Exonic
915345798 1:155196254-155196276 GGAGGGAAAGGGAGGCAGGAAGG + Intronic
915367069 1:155322648-155322670 CAGGGAAAATTGATGGAGGATGG + Exonic
915623409 1:157099606-157099628 GGGAGGACAGTGAAAGAGGAAGG + Exonic
915832320 1:159142509-159142531 TGGGGGAAAGAGATACAGGAGGG - Intronic
915835697 1:159173087-159173109 GTGGGGAGAGTGAAGGGGGAGGG + Intronic
916115543 1:161482120-161482142 CGGGTGACAGTGATGGACGAAGG - Intergenic
916176940 1:162049838-162049860 GGAGGGAAAGAGAGAGAGGAAGG - Intergenic
916314794 1:163437228-163437250 CTTGGGAAAGTGGTGGAGGAAGG - Intergenic
916611360 1:166395148-166395170 GGGGGAAAGGGGAAGGAGGAGGG + Intergenic
916914640 1:169392886-169392908 GTGGGGCAAGGTATGGAGGAAGG - Intronic
917231711 1:172844835-172844857 GGGGGGAGAGAGAGGGAGGGAGG + Intergenic
917817341 1:178724925-178724947 GGGGGGAAGGGGTAGGAGGATGG - Intergenic
918332344 1:183472371-183472393 GGGGGGAGGGGGAGGGAGGAGGG - Intronic
918469910 1:184861515-184861537 GGGGGGAAGAGGAGGGAGGAAGG + Intronic
919061616 1:192641360-192641382 AGGGGAAAAGGGAGGGAGGAAGG + Intronic
919090486 1:192973132-192973154 AGGGGGAGAGTGATGGGGGTAGG - Intergenic
919758133 1:201078710-201078732 GGGGGCAAAGCGTGGGAGGATGG - Intronic
919827905 1:201516826-201516848 GGGGGGAGAGGGAGGGAGGGAGG + Intergenic
919846955 1:201648502-201648524 GGGGAGAGAGCGAGGGAGGAGGG - Exonic
919989114 1:202696903-202696925 GGGAGGAAAGGTATGGATGAAGG - Intronic
920093615 1:203471650-203471672 TGGGGGAAAGTGAGTGATGAGGG + Intergenic
920647845 1:207816303-207816325 GAGGAGGAAGTGGTGGAGGAAGG + Intergenic
920742889 1:208598150-208598172 CTGGGAAAAGAGATGGAGGAGGG + Intergenic
920932877 1:210405298-210405320 GGGGGAAAAGTGAAGTAGGGGGG - Intronic
921221494 1:212977050-212977072 GGAGGGAAAGTAGTGGGGGAAGG + Intronic
921264402 1:213410465-213410487 GAGGGGAAAGTGGTAGGGGAGGG + Intergenic
921346423 1:214190242-214190264 GGCTGGGAAGTGTTGGAGGAGGG - Intergenic
922129065 1:222758720-222758742 GGGGTGGAAGTGAGGGAAGAGGG + Intergenic
922135805 1:222825152-222825174 GGGGGGGCAGTGGTGGGGGATGG + Intergenic
922356571 1:224782234-224782256 GGGGGGAGAGTGATAAGGGATGG + Intergenic
923012159 1:230096454-230096476 GGGGAGAACGAGATGGACGAGGG - Intronic
923052851 1:230401062-230401084 GGAGGGACAGTGAATGAGGAAGG - Intronic
923109519 1:230879780-230879802 GGGGGCAGACTGATTGAGGAGGG - Intergenic
923109532 1:230879817-230879839 GGGGGCAGACTGATTGAGGAGGG - Intergenic
923367061 1:233272990-233273012 TGGGGGAAAGAGTGGGAGGAGGG + Intronic
923392170 1:233523279-233523301 GGAGGGAAAGTGAAAGACGAGGG + Intergenic
923482570 1:234397715-234397737 GAGGGGGAAGAGAGGGAGGAGGG + Intronic
923509809 1:234640699-234640721 AGAGGGAGAGTGAGGGAGGAAGG + Intergenic
923519358 1:234724132-234724154 GGAGGGAGAGGGAGGGAGGAAGG + Intergenic
923608189 1:235464468-235464490 GGGGAGGAAGTGAGGGAGGAAGG - Intronic
923781505 1:237029626-237029648 AGGGGGAAAGTGATGAGTGAAGG + Intergenic
923809218 1:237293928-237293950 GGGTGGAATGTGTTGGGGGAAGG + Intronic
923988882 1:239412276-239412298 GGTGAGAAAGTGAGAGAGGAAGG - Intronic
924246884 1:242093821-242093843 GGGGGGAAAATGATGGAGAGAGG + Intronic
924274442 1:242371503-242371525 GGGGGATAAGGGATGGAGAAAGG - Intronic
924437608 1:244056641-244056663 GGGGGGAGAGTAAGGGAGGGAGG - Exonic
924851702 1:247837679-247837701 GGGGTGAGAGTGTTGGGGGAAGG - Intergenic
1062798050 10:358820-358842 GGGGGCAGAGGGATGGGGGATGG + Intronic
1063213860 10:3906207-3906229 GGGTGGAAAGGGGAGGAGGAAGG + Intergenic
1063225669 10:4013141-4013163 GGGAGGGAAGGGAAGGAGGAGGG - Intergenic
1063534184 10:6866931-6866953 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1063654099 10:7969897-7969919 GGGAGGAAGGAGACGGAGGAAGG - Intronic
1063662198 10:8042721-8042743 GGGGAGGAAGTGGGGGAGGAAGG - Intergenic
1063739175 10:8797938-8797960 GGGCTGAAAGGGATGGAGAACGG + Intergenic
1063806483 10:9649264-9649286 GGGTAGAAAGTCATGGAGAAAGG - Intergenic
1064397182 10:14991397-14991419 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1064400074 10:15013855-15013877 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1064409501 10:15092835-15092857 GGGGGGGAAGAAAGGGAGGAGGG + Intergenic
1064703974 10:18051172-18051194 GGGAGGAAGGGGATGGAGGGAGG + Intergenic
1064778841 10:18810742-18810764 GGAGCGACAGTGAGGGAGGATGG - Intergenic
1064795197 10:19004289-19004311 GGGTGGAAGGGGATAGAGGAAGG - Intergenic
1065098703 10:22311116-22311138 GGGGGGAAAGAGGAAGAGGAAGG - Intergenic
1065674294 10:28157653-28157675 GGGTGGAACCTGATGGAGAATGG - Intronic
1065950569 10:30647103-30647125 GGGGTGAGTGTGATGAAGGAAGG - Intergenic
1066076298 10:31881044-31881066 AGGGGGATAGAGATGGAGGAGGG - Intronic
1066334580 10:34463041-34463063 GGGAGGAAAGGGAAGGGGGAGGG + Intronic
1066362563 10:34745401-34745423 GGAAGGAAAGAGAGGGAGGAAGG + Intronic
1066371537 10:34822017-34822039 GGAGGGAGAGGGAGGGAGGAAGG + Intergenic
1066390444 10:34973770-34973792 GGAGGACAAGTGATGCAGGAAGG + Intergenic
1066402663 10:35090502-35090524 GGGGGGAAAGGGGAGAAGGACGG + Intronic
1066573710 10:36802421-36802443 GGGGGAAAAGGGGTAGAGGAAGG - Intergenic
1066596194 10:37052579-37052601 AGGGAGAAAGGGAGGGAGGAGGG + Intergenic
1067821129 10:49531800-49531822 GGGCTGAACGGGATGGAGGATGG - Intronic
1067853473 10:49769858-49769880 GGGGAGAGAGGGAGGGAGGAAGG + Intergenic
1068813504 10:61283326-61283348 CGGGAGGAAGTGATGGTGGAGGG + Intergenic
1069250952 10:66266090-66266112 GGAGAGAAAGAGAGGGAGGAAGG + Intronic
1069321328 10:67175125-67175147 GGAGGGAAAGGGAGGGAGGGAGG + Intronic
1069344492 10:67452024-67452046 AGGGAGAAAGGGATGGAGGGAGG + Intronic
1069430473 10:68330548-68330570 GGGGGGAAAGGGAGGTGGGACGG + Intronic
1069587637 10:69619060-69619082 TGGAGGAAAGTCAGGGAGGATGG - Intergenic
1069820227 10:71222960-71222982 GGTGGGATAGGGATGGGGGAGGG - Intronic
1069824466 10:71246584-71246606 GGGAGGGAAGTGAGGGAGGGAGG + Intronic
1069915561 10:71784646-71784668 GGAGGGGCAGTGATGGAGAAGGG - Intronic
1069948794 10:72005510-72005532 AGGGAGAAACTGATGGAGGTGGG + Intronic
1070383459 10:75902385-75902407 GGGTGGGAGGGGATGGAGGAGGG + Intronic
1070511638 10:77166591-77166613 GAGGGGAAGGACATGGAGGAGGG + Intronic
1070653158 10:78252465-78252487 GCCGGGAAAGGGATTGAGGAGGG - Intergenic
1070738816 10:78888402-78888424 GGGGGGAATGCAATGGAGCAGGG - Intergenic
1070771860 10:79087255-79087277 GATGGTAAAGTGTTGGAGGAAGG + Intronic
1071058366 10:81538541-81538563 GTGAGCAAAATGATGGAGGAAGG - Intergenic
1071249025 10:83796938-83796960 GAGGGGACAGGGAGGGAGGAGGG + Intergenic
1071751538 10:88482969-88482991 AGGAAGAAAGGGATGGAGGAAGG - Intronic
1072213646 10:93269939-93269961 TGGAGAAAAGTGATGGAAGAGGG + Intergenic
1072397300 10:95057836-95057858 GGTGGGAAAGAGTTGGTGGATGG - Intronic
1072432317 10:95384181-95384203 GAAGGGAAAGTGGTGGATGAGGG - Intronic
1072463260 10:95639771-95639793 GGGGGAAAACTGATGGAGAAGGG - Intronic
1072613046 10:97031681-97031703 CGGAGGAAGGAGATGGAGGAAGG + Intronic
1073101266 10:101007933-101007955 GGAGAAAAGGTGATGGAGGAAGG + Intronic
1073240672 10:102055930-102055952 GAGGGGAGAGGGAGGGAGGACGG - Intronic
1073577342 10:104638114-104638136 TTGGGGAAAATGATGGAGGCTGG + Intergenic
1073586139 10:104711882-104711904 GGAAGGGAAGTGAAGGAGGATGG + Intronic
1074419928 10:113299745-113299767 AGGAGGAAGGTGAGGGAGGAAGG + Intergenic
1074914995 10:117947094-117947116 GAGGAGAAAGTGATGAAGAAAGG - Intergenic
1074925854 10:118070062-118070084 GGGGGAAAGGTGATGGGAGATGG - Intergenic
1075105588 10:119538167-119538189 GAGGAGAGAGGGATGGAGGAAGG + Intronic
1075227331 10:120641301-120641323 GAGGGGAAGGTGATGAGGGAGGG + Intergenic
1075263364 10:120981097-120981119 GAGTGGAAAGGGATGGGGGAGGG - Intergenic
1075580685 10:123615798-123615820 GGGAGGAAAGTGGAAGAGGATGG - Intergenic
1075596506 10:123734117-123734139 AAAGGGAAAGAGATGGAGGAAGG - Intronic
1075661575 10:124200561-124200583 GGGAGGAAAGAGAAGGAGGTAGG + Intergenic
1075825460 10:125353808-125353830 GGGTGGAAATTGAGAGAGGAAGG + Intergenic
1075961023 10:126567780-126567802 GGGGGACAAGGGATGGGGGATGG + Intronic
1075987893 10:126803809-126803831 GAGGGGAAAGGGAAGGAGGCAGG - Intergenic
1076109156 10:127848221-127848243 GGGGGGAGAGAGAGGGGGGAGGG + Intergenic
1076270935 10:129151536-129151558 AGGGGGAGAGAGATGGAGGTGGG - Intergenic
1076595926 10:131623931-131623953 TGGGGGAAAGAGATGGAGAGAGG + Intergenic
1076638571 10:131899440-131899462 GGGAGGTAAGTGGAGGAGGATGG - Intergenic
1076846393 10:133071491-133071513 GGGGAGAAAGGGAGGGAGGGAGG - Intronic
1077304758 11:1864077-1864099 GGAGGGGAAGGGAGGGAGGAGGG + Intronic
1077373102 11:2192815-2192837 GGGGAGAAAGGGAGGGAGGGGGG - Intergenic
1077588989 11:3477239-3477261 AGAGGACAAGTGATGGAGGAAGG - Intergenic
1077923229 11:6656272-6656294 GGGGAGAAAATGATGGAGATGGG - Intergenic
1077993873 11:7436144-7436166 GAGTGGATAGTGATGGTGGAAGG - Intronic
1078171677 11:8933096-8933118 GGGCAGGAAGTGATGGGGGAGGG + Intergenic
1078245602 11:9571420-9571442 GGAGGGGAAGTGTTGGAGCAAGG + Intergenic
1078471661 11:11592510-11592532 GGGGGTAAGGTGAGGGAGCATGG - Intronic
1078702408 11:13699092-13699114 GGGACAAAAGTGAGGGAGGAAGG - Intronic
1078879829 11:15437144-15437166 GGAGGGAAAGTGGGGAAGGAAGG + Intergenic
1079130774 11:17745679-17745701 GGGAGGAAAGCCATGGAGGCTGG - Intronic
1079356139 11:19731560-19731582 GGGGGGATAGTTATTGAGGGAGG + Intronic
1079447209 11:20568488-20568510 GGAGGGATAGTGAGGGAGGTTGG - Intergenic
1079651226 11:22932691-22932713 GCAGGGAAAGAGAGGGAGGAAGG - Intergenic
1079683505 11:23326974-23326996 GGGGGGAGAGGGAGGGGGGAAGG + Intergenic
1079865518 11:25729080-25729102 GGTGGCAAAATGATGGAGGAAGG + Intergenic
1079898611 11:26152429-26152451 GGGGGGGAGGGGAGGGAGGAAGG + Intergenic
1080036856 11:27719772-27719794 AGGGGGAAAGAGAGGGAGGGAGG + Intronic
1080048905 11:27838439-27838461 GGGAGGGAAGGGAGGGAGGATGG - Intergenic
1080392985 11:31865436-31865458 GAGGGGACAGTGGTGGAGAAGGG + Intronic
1080441001 11:32294449-32294471 GGGGAGAGAGGGATGGAGGGAGG + Intergenic
1080536846 11:33230267-33230289 GGTGGGAAGGGGATGGATGATGG + Intergenic
1081489289 11:43554888-43554910 GGAGGGCAAGTGAGGGAGGGAGG + Intergenic
1081588616 11:44405353-44405375 GGGGAGAGGGTGGTGGAGGAAGG - Intergenic
1081710586 11:45213062-45213084 GGAGGAAGAGTCATGGAGGAGGG + Intronic
1082216986 11:49583380-49583402 GGAAGGAAAGAGAAGGAGGATGG - Intergenic
1082244444 11:49905219-49905241 GGGGGGAAATAGAAGGGGGAAGG + Intergenic
1082681257 11:56173578-56173600 GGTGCAAAAGTGATGGAGGTAGG - Intergenic
1083187123 11:61024236-61024258 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1083296605 11:61718627-61718649 GGGTGGAGAGTGAGGGAGCATGG - Intronic
1083495457 11:63048005-63048027 GTGGGCAAAGGCATGGAGGAGGG + Intergenic
1083592991 11:63906170-63906192 GGGGAGTTAGTGATGGAGGCAGG - Intronic
1083738687 11:64696066-64696088 GGGAGCAGAGAGATGGAGGAAGG - Intronic
1083967871 11:66053693-66053715 AGGGGGGAGGTGATGGGGGAGGG + Intronic
1084227665 11:67727377-67727399 GGAGGACAAGTGATGGAGGAAGG - Intergenic
1084244687 11:67848862-67848884 AGAGGACAAGTGATGGAGGAAGG - Intergenic
1084261075 11:67979051-67979073 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1084347671 11:68566313-68566335 AGGAGGAAAGAGAAGGAGGAAGG - Intronic
1084472140 11:69368769-69368791 GGGGGAAGAGGGATGCAGGAGGG - Intergenic
1084533962 11:69746031-69746053 AGGGGCAAAGAGATGAAGGAGGG + Intergenic
1084580026 11:70017482-70017504 GGGAGGGAAGTAAAGGAGGAAGG - Intergenic
1084742886 11:71150399-71150421 GGAGGGACAGGGAGGGAGGAAGG + Intronic
1084772580 11:71353318-71353340 GGGAGGAAAATGAAGGAGGTTGG - Intergenic
1084807556 11:71589488-71589510 GAAGGACAAGTGATGGAGGAAGG + Intronic
1084827997 11:71745694-71745716 AGAGGACAAGTGATGGAGGAAGG + Intergenic
1084844654 11:71889495-71889517 GAAGGACAAGTGATGGAGGAAGG + Intronic
1084859934 11:72011661-72011683 GGTAGGAGAGTGATGGAGAAAGG + Intronic
1084952955 11:72676848-72676870 GGCAGGCAATTGATGGAGGAGGG - Intergenic
1085445797 11:76599775-76599797 GGGGAGCAAGTGAGGCAGGAAGG + Intergenic
1085454551 11:76658361-76658383 GGGTGGAAAGGAAGGGAGGAGGG + Exonic
1085513681 11:77100367-77100389 GGGGGAAAAGGAATGGAAGAGGG - Intronic
1085931565 11:81089379-81089401 GGGGGGAAAGGAAAGAAGGAAGG - Intergenic
1085976003 11:81655918-81655940 GGGGGGAGAGGGAGGGAGCAGGG + Intergenic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086518765 11:87646102-87646124 AGGGGGAAAGGGAAGGGGGAAGG - Intergenic
1086632568 11:89040786-89040808 GGAAGGAAAGAGAAGGAGGATGG + Intronic
1087673159 11:101129112-101129134 GAGGGAAAAGGGAAGGAGGAGGG + Exonic
1088076729 11:105858650-105858672 GGAAGGATAGTGAGGGAGGAGGG - Intronic
1088258699 11:107925246-107925268 GAGGGAAAAGAGATGAAGGAAGG + Intronic
1089139242 11:116273089-116273111 GGGAGCAAAGGGAAGGAGGAAGG + Intergenic
1089291289 11:117439214-117439236 GTGGGGACAGGGATGGAGAAAGG - Intronic
1089619632 11:119714765-119714787 GGTGGGAAAGGGATAGAGGGAGG + Intronic
1090239088 11:125169439-125169461 GGTGGGAAAGGGAGGAAGGAGGG + Intronic
1090244649 11:125207223-125207245 GGGAGGAAAGGAAGGGAGGAGGG - Intronic
1090579995 11:128148986-128149008 GTGGGGACAGTGAGGGAGGCTGG + Intergenic
1090623550 11:128584849-128584871 GGGAGGAAAGGGAAGGAGGAGGG + Intronic
1090636573 11:128693673-128693695 TGGGGGAAGGTGATGGGGGGAGG + Intronic
1090990397 11:131812225-131812247 GGGGAGAATGAGAGGGAGGAAGG - Intronic
1091021514 11:132104334-132104356 GGGGGAAAATGGAGGGAGGAAGG - Intronic
1091137164 11:133202289-133202311 AGAGGGAAAATGATGGAGGATGG - Intronic
1091568445 12:1663864-1663886 AGGGGGAAAGGAAGGGAGGAAGG + Intergenic
1091842019 12:3628137-3628159 TGGGGGAGAGGGAGGGAGGAAGG - Intronic
1091872738 12:3908473-3908495 GTGGGGAAGGAGATGGGGGAAGG - Intergenic
1092113581 12:5982243-5982265 TGTGGGAAAGTGATAGAGCAGGG - Intronic
1092432336 12:8419619-8419641 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1092778613 12:11965178-11965200 AGGGAGAAAGTGAGGAAGGAAGG - Intergenic
1092902416 12:13072153-13072175 GGGGGGAACCTGACGGAGGCAGG + Intronic
1093016204 12:14156868-14156890 GGGAGGTAAGCAATGGAGGAAGG + Intergenic
1093173237 12:15882470-15882492 GGAGGGAAAGGGAGGGAGGGAGG - Exonic
1093218560 12:16391301-16391323 GGGGGGAAAGGGAAAGGGGAGGG - Intronic
1093448980 12:19293782-19293804 TGTGGGAAAGTGATTGAGGAAGG - Intronic
1093838035 12:23860145-23860167 GGGGGGAAACGGTGGGAGGAGGG + Intronic
1094166172 12:27446281-27446303 GGGGAGAGAGAGATGGAGGAGGG + Intergenic
1094724629 12:33101203-33101225 GCAGGGAAAGTGAAGGAGAAAGG + Intergenic
1095168081 12:38998380-38998402 GGGGAGAAAGGGAAGGGGGAGGG - Intergenic
1095417818 12:41995223-41995245 GGGAGGAAAGAAATAGAGGAAGG + Intergenic
1095621487 12:44260745-44260767 GGGTGGGAAGGGGTGGAGGATGG - Intronic
1095817554 12:46441220-46441242 GGGGGGGAAGGGAGGGAGGGAGG - Intergenic
1096219886 12:49822519-49822541 GGGGAGAACGCGATGGAGGTGGG + Intronic
1096508967 12:52116573-52116595 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1096707435 12:53431152-53431174 GGGGGGAATGACAGGGAGGAAGG - Intronic
1096933234 12:55239357-55239379 AGGGGAAAAGAGATGGAGAATGG + Intergenic
1097069363 12:56343589-56343611 GCAGGGAAAGGGAGGGAGGATGG + Intronic
1097281906 12:57850188-57850210 GAGGGGTAAATGAGGGAGGAGGG + Intergenic
1097282176 12:57851923-57851945 TGGGGGAAAGTGCTGGAGATGGG - Intergenic
1097607577 12:61774663-61774685 CGGGGGAAAGAGTGGGAGGATGG + Intronic
1097661906 12:62439482-62439504 GAGGGCAAAGTGTGGGAGGAGGG - Intergenic
1097718939 12:62999577-62999599 GGGAGGAGAGAAATGGAGGATGG + Intergenic
1097751699 12:63361918-63361940 GAGGGGAAAGGGAGGGAGGGAGG - Intergenic
1098343135 12:69471591-69471613 GGGGAGAAAGTGATGTAGGTAGG + Intronic
1099644232 12:85330426-85330448 GTGGAGAAAGGGAGGGAGGAAGG - Intergenic
1099766005 12:86985171-86985193 TGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1099868068 12:88309507-88309529 AGGGAGAAAGTAAGGGAGGAAGG - Intergenic
1099868076 12:88309543-88309565 GAGGAGAAAGAGAAGGAGGAGGG - Intergenic
1100149294 12:91715847-91715869 GGGGTCAGAGAGATGGAGGAGGG + Intergenic
1101157851 12:101944420-101944442 GGGTGGCAAGTGATATAGGAGGG + Intronic
1101348157 12:103905251-103905273 GGGGGGAGGGAGAGGGAGGAAGG + Intergenic
1101816193 12:108147934-108147956 GGGGTGAAAGTGATGGTGATGGG - Intronic
1102082988 12:110113401-110113423 GGGAGGAAAGAGAGAGAGGAAGG + Intergenic
1102329908 12:112020129-112020151 GGGTGGAATGTGAAGGAAGAGGG - Intronic
1102394491 12:112574959-112574981 GGGAGGAGGGTGGTGGAGGAGGG + Intronic
1102451495 12:113045058-113045080 GGGGGGAAAAGGAAGGAGGAGGG + Intergenic
1102457966 12:113082474-113082496 GAGGGGAAAGGGATGGAGGTGGG + Intronic
1102490449 12:113287121-113287143 AGGGAGAAAGAGAGGGAGGACGG + Intronic
1102526578 12:113516263-113516285 AGGGAGGAAGGGATGGAGGAAGG - Intergenic
1102720783 12:115014140-115014162 GGGAGTAAAGGGAGGGAGGATGG + Intergenic
1102773574 12:115499533-115499555 GGGGGGAAGGTAATGGAGTTGGG + Intergenic
1102853741 12:116276724-116276746 GGGGGGAAAGGGGAGGAGAAGGG + Intronic
1102919031 12:116778081-116778103 GGGAGGAAAGGCAGGGAGGAAGG - Intronic
1103030204 12:117606611-117606633 GGGAAGAAAGGGAGGGAGGAAGG - Intronic
1103567369 12:121823322-121823344 GGGGGGGAAGGGGTGGTGGAGGG - Exonic
1103799275 12:123526772-123526794 GGGGTGGAAGTGGTGGTGGAGGG + Intronic
1104033798 12:125084362-125084384 GGGGAGGAAGTGAGGGAGGGAGG - Intronic
1104034249 12:125087535-125087557 GAGGGGAAAGGGAGGGAGGTCGG - Intronic
1104239266 12:126971712-126971734 GGGGAGAAAGAGAAGGAGGAAGG - Intergenic
1104310966 12:127654019-127654041 GGAGCGAAGGTCATGGAGGAAGG - Intergenic
1104752620 12:131249582-131249604 AGGGGGAAGTTGCTGGAGGATGG - Intergenic
1104842650 12:131832162-131832184 GGGGGGGAAGGGAAGGGGGAAGG + Intronic
1104951882 12:132444855-132444877 GGGGTGAAAGTGATGTGGGTTGG - Intergenic
1104956767 12:132470559-132470581 GGAGGGGAAGGGAGGGAGGAGGG + Intergenic
1104970315 12:132528005-132528027 AGGGGGACAAAGATGGAGGAGGG - Intronic
1105680154 13:22717860-22717882 GGAGGGAAAGAGATGGACAATGG - Intergenic
1106033820 13:26026153-26026175 GGGAGGGAAGTAATGGAGGAAGG - Intergenic
1106306651 13:28517036-28517058 TGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1106323656 13:28666766-28666788 GTGGTGATAGTGATGGAAGATGG + Intronic
1106550790 13:30769182-30769204 GGGCGGAAAGGAATGGAGGAAGG - Intergenic
1106626957 13:31430571-31430593 GTGGGAAAAGTGAAGGAGGAGGG - Intergenic
1106768685 13:32941163-32941185 GGAGGGAAAGAGATGGGGGCTGG - Intergenic
1106793188 13:33177721-33177743 AGGGAGAAAGGGAGGGAGGAAGG + Intronic
1106840859 13:33683665-33683687 GGGGAGAAGGTGAGGGAGGTGGG + Intergenic
1108230984 13:48340034-48340056 GGTGCGAAGGTAATGGAGGAAGG + Intronic
1108750093 13:53439818-53439840 GGGGGGAGGGGGATGGGGGAGGG - Intergenic
1108794768 13:54017812-54017834 GGAGGGAAAGGGAGGGAGGAAGG + Intergenic
1108794786 13:54017857-54017879 GGAGGGAAAGGGAGGGAGGAAGG + Intergenic
1108991667 13:56666282-56666304 GGTGGGAAAAGGATAGAGGATGG + Intergenic
1108994092 13:56702682-56702704 GCTGGGACAGTGTTGGAGGAGGG + Intergenic
1109374818 13:61478603-61478625 GAGGGTAAAGGGAGGGAGGAAGG - Intergenic
1109614906 13:64820101-64820123 GAGGGGAGAGAGTTGGAGGAGGG + Intergenic
1109671325 13:65612233-65612255 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1109702049 13:66038970-66038992 GGGAGGAAAGAAAAGGAGGAAGG - Intergenic
1109799582 13:67358706-67358728 AGGGGGAAAGAGAAGAAGGAAGG - Intergenic
1110281402 13:73698193-73698215 GAGGGGAAAGGGAAGGAGGAGGG + Intronic
1110356551 13:74574105-74574127 TGGGGCAATGTGGTGGAGGAAGG + Intergenic
1110562144 13:76920655-76920677 TGGGGGAAAGAGTGGGAGGAGGG + Intergenic
1111446066 13:88347650-88347672 GGGGAAAAAGGGAGGGAGGAAGG + Intergenic
1111446077 13:88347692-88347714 GGGGAAAAAGGGAGGGAGGAAGG + Intergenic
1111876040 13:93897175-93897197 GGGAGGAGAGTGATGAAGAAAGG + Intronic
1111893001 13:94106520-94106542 GTGAGGGAAGTGAGGGAGGATGG + Intronic
1112433310 13:99372381-99372403 GGGGGGAAAATGAAGGATGATGG + Intronic
1112659208 13:101488054-101488076 GGGAGAGAAGGGATGGAGGATGG + Intronic
1113074205 13:106451985-106452007 GGGAGGAAAGAAAGGGAGGAAGG + Intergenic
1113151335 13:107267392-107267414 GGAGGGAAGGAGATGGAGGTGGG + Intronic
1113966078 13:114154891-114154913 TGGGGCAAAGTGGTGGGGGATGG + Intergenic
1114122667 14:19687495-19687517 AGGGGGAAAGGGAGGGAGGGAGG - Intergenic
1114563734 14:23612549-23612571 GAGGGGAAAGTGCAGTAGGATGG + Intergenic
1114697624 14:24642530-24642552 GCTGGGAAAGGGATAGAGGAAGG - Intergenic
1115301969 14:31894709-31894731 GGGCCGAAAGTGAGGGAGGTTGG - Intergenic
1115657990 14:35462538-35462560 GAGGGGAAGGGGAGGGAGGAAGG - Intergenic
1116630028 14:47318792-47318814 GGGGGGAAAGGGAGGAAAGAAGG + Intronic
1116651891 14:47604251-47604273 GGAGAGAAAGGGATGGAGGTGGG - Intronic
1116974137 14:51096296-51096318 GGGGGGAAAGGAAAGGCGGAAGG + Intergenic
1117038837 14:51751966-51751988 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1117084570 14:52186109-52186131 GAGGGGAAAGTGGAGAAGGAGGG - Intergenic
1117914068 14:60658623-60658645 GGGGGGACGGTGAAGGAGGCTGG + Intergenic
1118595699 14:67433643-67433665 TGGGGGAAAAAGAAGGAGGAGGG + Intergenic
1118998783 14:70862089-70862111 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1119116978 14:72032613-72032635 GGGTGCCAAGTGTTGGAGGAGGG - Intronic
1119736309 14:76984942-76984964 AGGAGGAAGCTGATGGAGGAGGG - Intergenic
1119770020 14:77214657-77214679 GGGGAGACAGTGAGGGGGGAAGG - Intronic
1119900789 14:78257932-78257954 GGGTGGGTAGTGATGGAAGAAGG + Intronic
1120677926 14:87443482-87443504 GGAAGGAAAGAGAGGGAGGAAGG + Intergenic
1121308819 14:92923832-92923854 GCGGGGGAAGAGATGGAGGAAGG - Intronic
1121764921 14:96478186-96478208 GCGGGGGAAGGGAGGGAGGAAGG + Intronic
1121798918 14:96757215-96757237 AGGGGGAAGAGGATGGAGGAGGG + Intergenic
1122002068 14:98666966-98666988 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1122600564 14:102919655-102919677 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600579 14:102919718-102919740 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600594 14:102919781-102919803 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600608 14:102919844-102919866 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600622 14:102919907-102919929 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600637 14:102919970-102919992 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600651 14:102920029-102920051 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600665 14:102920092-102920114 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122600681 14:102920169-102920191 GGATGGAAGGTGATGGTGGATGG - Intergenic
1122631427 14:103109323-103109345 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631441 14:103109359-103109381 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631455 14:103109395-103109417 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631469 14:103109431-103109453 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631483 14:103109467-103109489 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631497 14:103109503-103109525 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631525 14:103109576-103109598 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631539 14:103109612-103109634 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122631553 14:103109648-103109670 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1122861983 14:104586819-104586841 GGGAGGAGGGTGTTGGAGGAGGG + Intronic
1122868483 14:104621838-104621860 GGAGGGAAAGAGAGAGAGGAAGG + Intergenic
1122879453 14:104683495-104683517 GAGGGGAGAGTGAAGGAGAAGGG + Intergenic
1123118999 14:105908420-105908442 GGGGAGAAAGGGCTGGAGGAGGG + Intergenic
1123121227 14:105918010-105918032 GGGGAGAAAGGGCTGGAGGCAGG + Intronic
1123541059 15:21292023-21292045 GGGGGGAAGTTAATGGGGGAAGG + Intergenic
1123917712 15:25049035-25049057 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1123975493 15:25550046-25550068 GGAGGGAAAGTGGTAAAGGAGGG + Intergenic
1124153115 15:27200016-27200038 AGGGAGAAAGTAAGGGAGGAAGG - Intronic
1125307924 15:38343077-38343099 GGGAGGACAGTGATGGAGTAAGG + Intronic
1125357429 15:38831209-38831231 GGGGTGAAAGTGGAGGAGAAAGG + Intergenic
1125556576 15:40590753-40590775 GGGAGCAACGTGATGCAGGAAGG + Intergenic
1125898711 15:43325696-43325718 GGGGGGAAAAGAAGGGAGGAGGG - Exonic
1125922142 15:43531256-43531278 GGGGAAAATGAGATGGAGGAAGG + Exonic
1126142501 15:45449771-45449793 GAGGGGAAGGGGAGGGAGGAGGG + Intergenic
1126181949 15:45793954-45793976 GGGGGCAAAGAGATGGAGATGGG + Intergenic
1126349041 15:47725544-47725566 AGGGGGAAGGTGAGGGAGGTGGG - Intronic
1126429910 15:48571747-48571769 GGAGTGAAATTGTTGGAGGATGG - Intronic
1126628778 15:50712656-50712678 GGGGGGGGAGGGAGGGAGGAAGG - Intronic
1127378443 15:58406758-58406780 GTGGGGATAGTGAGGGTGGAGGG - Intronic
1127455912 15:59155859-59155881 GGGGGGAAGGTGGGGGTGGATGG + Intronic
1127692532 15:61412188-61412210 GGTGGAAAACTGATGGATGAAGG + Intergenic
1127704715 15:61535478-61535500 GGGGTGTCAGTGATGGAGCATGG + Intergenic
1127736158 15:61840833-61840855 GGAAGGAAAGGGAGGGAGGATGG - Intergenic
1127920168 15:63488148-63488170 AGGTGGAAAGGGAGGGAGGAGGG - Intergenic
1128154750 15:65385370-65385392 GGGGAGAGGGTGAGGGAGGACGG + Intronic
1128365027 15:66993404-66993426 GGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1128377234 15:67085830-67085852 GGGTGGAAAGTGATAGTGGTTGG + Intronic
1128462572 15:67882380-67882402 GAGGGGGAAGGGATGGAGGAAGG + Intergenic
1128548063 15:68580412-68580434 GGGGTGCAAGTGATGGAGGTGGG + Intronic
1128783210 15:70376466-70376488 AGGGAGAAAGGGATGGAAGAGGG + Intergenic
1128878584 15:71222613-71222635 GGGGTGAAAGAGGTTGAGGAGGG + Intronic
1128942332 15:71799086-71799108 GGGAGGGAAGGGATGGAGGGAGG - Intronic
1129044885 15:72725780-72725802 GGGGGAAGAGGGAAGGAGGAAGG - Intronic
1129161806 15:73751943-73751965 GGGGGGAAGGTGGGGGGGGAGGG - Intronic
1129446883 15:75625236-75625258 AGGGGGAAGGGGATGGGGGAGGG - Intronic
1129695273 15:77737432-77737454 GGGAGGAAGGAGAGGGAGGAAGG + Intronic
1129854013 15:78811473-78811495 GGAGGGAGAGTGAGGGAGGGCGG + Intronic
1129924606 15:79352063-79352085 GGGGGGAAAGAGTAGGAGGGGGG + Intronic
1130011226 15:80154237-80154259 GAGGGCAAAGTGTTTGAGGAGGG - Intronic
1130148624 15:81294166-81294188 GGGGTGAAAGTGAAGGAGGGAGG + Intronic
1130300740 15:82678506-82678528 AGGGGGACAGTGATGGGAGATGG - Intronic
1130862310 15:87901776-87901798 GGGGAGAAAGGGAGAGAGGAAGG + Intronic
1131571540 15:93542152-93542174 GGAGGGGATGAGATGGAGGAAGG + Intergenic
1131947063 15:97635204-97635226 GGGTGGAAGGAGAAGGAGGAGGG - Intergenic
1132209751 15:100011276-100011298 GGGAGGGAAGTAAAGGAGGAGGG + Intronic
1132399306 15:101495758-101495780 GGGGGGAAGGGAAGGGAGGAGGG + Intronic
1202949372 15_KI270727v1_random:19164-19186 GGGGGGAAGTTAATGGGGGAAGG + Intergenic
1132771411 16:1565488-1565510 GGTGGTCAAGTAATGGAGGAGGG + Intronic
1132913516 16:2328585-2328607 GCAGGGAAGGCGATGGAGGAGGG + Exonic
1132989948 16:2787320-2787342 GGGGGGTGAAGGATGGAGGAGGG - Intronic
1133392805 16:5422947-5422969 GGGAGGAAAGAGGAGGAGGAGGG + Intergenic
1133392843 16:5423057-5423079 GGGAGGAAAGAGGAGGAGGAAGG + Intergenic
1133444790 16:5850868-5850890 GTGGGAGAAGTGATGAAGGATGG + Intergenic
1133507030 16:6422389-6422411 GAGGGGAAAGACAGGGAGGAGGG - Intronic
1133520118 16:6549103-6549125 GGGAGGAAAGAGAAGGAAGAGGG + Intronic
1133593983 16:7272923-7272945 GGGAAGGAAGTGAGGGAGGAAGG - Intronic
1133657739 16:7882563-7882585 GGGTGGAAAGTGAGGTGGGAAGG + Intergenic
1133668264 16:7992421-7992443 GGAGAGAAAGAGAAGGAGGAAGG + Intergenic
1133749499 16:8713563-8713585 GGAGGGAAGGTGAAGGAGGAGGG - Exonic
1133758685 16:8781225-8781247 GGGGGGAAAGTGATGCCTGTTGG - Intronic
1133839415 16:9394476-9394498 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1134183787 16:12067370-12067392 GGAGGGAATGGCATGGAGGATGG + Intronic
1134334934 16:13289577-13289599 GCAGTGAAAGTGATGAAGGAGGG + Intergenic
1134357157 16:13493069-13493091 GGGGGAAAAGTGGAGGAGAAGGG + Intergenic
1134488949 16:14681200-14681222 GGGGGGAGAGAGAGAGAGGAGGG + Intronic
1134599028 16:15518856-15518878 GGGAGGAAAGAAAAGGAGGAAGG + Intronic
1134743167 16:16566482-16566504 GGGGGGGAAGGGAGGGAGGGGGG - Intergenic
1134924393 16:18145978-18146000 GGGGGGGAAGGGAGGGAGGGGGG + Intergenic
1135187620 16:20328804-20328826 GAGGGGGAAGGGGTGGAGGATGG - Intergenic
1135480704 16:22818620-22818642 GGGGAGAGAGGGAAGGAGGAAGG - Intronic
1135534430 16:23282078-23282100 GGTGGGAAAGGGATGAAGGATGG + Intronic
1135814921 16:25623754-25623776 GGAGGGAAAGGGTAGGAGGAAGG + Intergenic
1135939621 16:26809874-26809896 GGAAGGAAAGAGAGGGAGGAAGG + Intergenic
1136232461 16:28894663-28894685 AGGAGGAAAGGGTTGGAGGAAGG + Intronic
1136574498 16:31115517-31115539 GGGGGGAAAGAAAAGGAGGCTGG - Intergenic
1136609687 16:31358699-31358721 GGGGTGACATTGAGGGAGGAAGG + Intronic
1136932336 16:34430646-34430668 TGGGGGGAAGAGAGGGAGGAAGG - Intergenic
1136972236 16:34981168-34981190 TGGGGGGAAGAGAGGGAGGAAGG + Intergenic
1137218675 16:46426530-46426552 AGGGAGAAAGGGAGGGAGGAGGG - Intergenic
1137457456 16:48628928-48628950 GTGGGGAAAGTGATCGCAGAAGG - Intergenic
1137887915 16:52126519-52126541 GAGGGGATAGTGAGAGAGGAAGG - Intergenic
1137955413 16:52824492-52824514 GAGGGGAAGGTGAGGAAGGAAGG - Intergenic
1137955419 16:52824511-52824533 GAGGGGAAGGTGAGGGAGGGAGG - Intergenic
1137955427 16:52824530-52824552 AGGGGGAAGGTGAGGGAGGGAGG - Intergenic
1138395159 16:56698404-56698426 GGAGGGACAGTGGAGGAGGAAGG - Intronic
1138462001 16:57154663-57154685 ATGGGGAAACTGAAGGAGGAAGG + Intronic
1138527667 16:57618372-57618394 GGGGAAAGAGTGATGGAGGTGGG - Intronic
1138705558 16:58911654-58911676 GGGGGACAAATGATGGGGGAAGG + Intergenic
1138835410 16:60428870-60428892 GAAGGGAAAGAGAAGGAGGATGG + Intergenic
1139060948 16:63250702-63250724 GAGGGGAAGGGGAAGGAGGAGGG + Intergenic
1139310748 16:66026049-66026071 AGGAGGAAAGAGACGGAGGAGGG + Intergenic
1139341402 16:66270231-66270253 GGGGAGAAAATGAAGGAGGGAGG + Intergenic
1139363663 16:66419390-66419412 GGAGGGAAGGTGAGGGAGGGAGG + Intergenic
1139586941 16:67909951-67909973 GTGGGAAAAGTGAGGCAGGAAGG + Intronic
1139818613 16:69700084-69700106 GGGAGGAAAGGGAGGGAGGAAGG - Intronic
1139966814 16:70750365-70750387 GGGAGGAAAGAGAGGGAGGGAGG + Intronic
1140270149 16:73458313-73458335 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1140309444 16:73835004-73835026 AGGAGGAGAGCGATGGAGGAAGG + Intergenic
1140466436 16:75186836-75186858 GGGAGAAATGAGATGGAGGAAGG + Intergenic
1140528762 16:75646612-75646634 TTGGGGAAAGCGATGGAGAAGGG + Intronic
1140728943 16:77838843-77838865 GGGGAGAAAGAGAAGGAGGAAGG - Intronic
1140874397 16:79137680-79137702 CGGGGGAAGGAGACGGAGGAGGG - Intronic
1140874406 16:79137704-79137726 GGCAGGAAGGGGATGGAGGAGGG - Intronic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141682941 16:85554776-85554798 GGGGGGGGAGGGAGGGAGGACGG + Intergenic
1141720469 16:85752619-85752641 GGGAGGTGACTGATGGAGGAGGG - Intergenic
1141808494 16:86358021-86358043 GCGGGGAAAGGGGTGGAGGGGGG - Intergenic
1142208061 16:88793369-88793391 GCGGGGAGAGTGAGGCAGGACGG - Intergenic
1142523062 17:518599-518621 GGGAGTAAAGAAATGGAGGAAGG + Exonic
1142742693 17:1940424-1940446 GAGGGGAAACTGAGGTAGGAGGG - Intronic
1143351165 17:6289241-6289263 GGGTGGTAAGTGATGGAGCAGGG + Intergenic
1143461765 17:7108667-7108689 GGAGGGGAAGGGATGGAGGCGGG - Intronic
1143565285 17:7717194-7717216 GCGGGGAAAGGGAGGGAAGACGG - Intergenic
1143624945 17:8104297-8104319 AGGGGGAAAGTGAGGAAGTAGGG + Intronic
1144003043 17:11073360-11073382 GAGGGGAAAGTAATGGCGGAGGG - Intergenic
1144278782 17:13703303-13703325 GGGGGGGAAGTGAGGGAGGGGGG + Intergenic
1144942046 17:18948566-18948588 GGGTGGGGAGTGATGGAGGGTGG + Intergenic
1144955779 17:19018139-19018161 GGGAAGAAAGGGAGGGAGGAAGG + Intronic
1145058492 17:19718049-19718071 GTGGAGAAGGTGTTGGAGGAGGG - Intronic
1145751999 17:27361798-27361820 GGTGGGAAAGTGTTGGAGGAAGG - Intergenic
1145864805 17:28234214-28234236 GGAGGACAAGTGATGGAGGAAGG - Intergenic
1145907685 17:28525148-28525170 GGGGGGCAAGTGGGGGAGGTAGG + Intronic
1145970142 17:28951374-28951396 GGGGGGAGGGTGATGGGGGGTGG + Exonic
1145971698 17:28960025-28960047 AGCAGGAATGTGATGGAGGAGGG + Intronic
1145984720 17:29037749-29037771 GGGGGCAAAGGGAGGGAGGATGG + Intronic
1145984919 17:29039208-29039230 GTGGGGACAGAGATAGAGGAGGG - Intronic
1145988031 17:29060701-29060723 GGGGGGTGAGTGAGGGAGGATGG + Intergenic
1146422210 17:32698277-32698299 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1146430387 17:32787741-32787763 GAGGGGAAAGGGAGGGAGGTGGG - Intronic
1147384966 17:40075654-40075676 GAGGGGAAGGTGATGGGGGAGGG - Intronic
1147422654 17:40330382-40330404 GGGGGGGAAGTGGTGTAAGAGGG + Intronic
1147498753 17:40942321-40942343 GAGGGGGAAGAGAGGGAGGAGGG - Intergenic
1147820613 17:43239451-43239473 GGGGGGAAAGAGAGGGAGAGAGG + Intergenic
1147826366 17:43272651-43272673 GGGGGGAAAGAGAGGGAGAGAGG + Intergenic
1147827255 17:43277504-43277526 GGGGGGAAAGAGAGGGAGAGAGG + Intergenic
1147908714 17:43841576-43841598 ACAGGGAAAATGATGGAGGAGGG - Intergenic
1147962367 17:44175856-44175878 TAGGGGAAAGTGGAGGAGGATGG + Intronic
1148020851 17:44552511-44552533 GGGGTGAAATAGATGGAGTAGGG - Intergenic
1148150066 17:45391621-45391643 TGAGGGAGACTGATGGAGGATGG + Intergenic
1149434776 17:56624039-56624061 GTAGGGAAAGTGTAGGAGGAGGG + Intergenic
1149503273 17:57171379-57171401 GGAGAGAAAGTCCTGGAGGAAGG + Intergenic
1149522037 17:57324720-57324742 TGGAAGAAAGTGAAGGAGGAGGG - Intronic
1149649810 17:58269635-58269657 GGGTGGAAGGTGAGGGAGGAGGG + Intergenic
1150202517 17:63372047-63372069 GGAGGGAGAGTGCTGGGGGAAGG + Intronic
1151048889 17:70953532-70953554 TGGGGGAAAGAGTGGGAGGAGGG + Intergenic
1151476149 17:74345249-74345271 GGTGGGAAGGGGAAGGAGGATGG + Intronic
1151565599 17:74895980-74896002 AGTGGGAAAGGGAGGGAGGAGGG - Intergenic
1151699997 17:75737814-75737836 GTGGGGACCGTGGTGGAGGATGG - Intronic
1152093716 17:78260716-78260738 TGTGGGAAAGTGGGGGAGGAGGG - Intergenic
1152223931 17:79083951-79083973 GGTGGGTGAGTGACGGAGGACGG + Exonic
1152307479 17:79529731-79529753 GGAGGGAGAGTGAGGAAGGAAGG + Intergenic
1152329005 17:79659823-79659845 GGGGGGAAGGGGAGGGAAGAGGG - Intergenic
1152510058 17:80780756-80780778 GGGGGGAGGGTGAGGGGGGAAGG - Intronic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1153997167 18:10453522-10453544 GGGGGAAAACTGCTGGAAGAGGG + Intergenic
1155130978 18:22933902-22933924 GGGGAGAAATGGATGGAGAAGGG + Exonic
1155283606 18:24266214-24266236 GTGGGGAAAGCCAGGGAGGAAGG - Intronic
1155444548 18:25897415-25897437 GGGGGGAGAAAGATGGAGGTGGG - Intergenic
1155545960 18:26915429-26915451 GGGGGGAAATTGTTTCAGGATGG - Exonic
1155576403 18:27252505-27252527 GGGGGGAAAGAGGAGGAGGAAGG + Intergenic
1155813770 18:30276298-30276320 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
1155829200 18:30491880-30491902 GGGAGGGAAGGGATGGAGGGAGG + Intergenic
1156208639 18:34913865-34913887 GAGGGGAAGGTGATGGAGTGGGG - Intergenic
1156381660 18:36567288-36567310 AGGGAGGAAGAGATGGAGGAAGG + Intronic
1156738353 18:40292256-40292278 GGGGGGATGGGGAGGGAGGAAGG - Intergenic
1156987508 18:43365870-43365892 AGGGAGAGAGTGAGGGAGGAGGG + Intergenic
1156991990 18:43420259-43420281 GGAGGGGAAGGGATGGAGGAAGG - Intergenic
1157335552 18:46734576-46734598 GGAGGGAAAATGGTGGAGGTAGG + Intronic
1157699465 18:49751769-49751791 AGGCGGAAAGTGCTGGAAGAGGG - Intergenic
1158519791 18:58162334-58162356 GGGGGGAAGCTGGTGAAGGATGG - Intronic
1158528177 18:58234263-58234285 AGGGGGGAAGGGAGGGAGGAAGG - Intronic
1158565337 18:58550275-58550297 GGGTTGTACGTGATGGAGGAGGG - Intronic
1158851089 18:61496184-61496206 GGGGGGAGAGGAAGGGAGGAGGG - Intronic
1159190806 18:65039713-65039735 GGGTGAAAAGGGATGGAGGAGGG - Intergenic
1159673370 18:71251002-71251024 GGGGAGAAGGTGGGGGAGGAAGG + Intergenic
1160329218 18:77977199-77977221 GGGAGGCCAGTGGTGGAGGAGGG - Intergenic
1160356088 18:78229531-78229553 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
1160450531 18:78961164-78961186 AGAGGGAGAGGGATGGAGGAAGG + Intergenic
1160716251 19:578144-578166 GGAGGGAAACTGAGGGAGGCGGG - Intronic
1160758624 19:771638-771660 GGGGAGATAGGGAGGGAGGAGGG - Intergenic
1161038698 19:2098837-2098859 GGGGGTAAAGGGAGAGAGGAGGG + Intronic
1161241084 19:3224502-3224524 GGGGGGAAACTGAGGCCGGAAGG - Intergenic
1161265444 19:3361405-3361427 TGGGGGCAAGTGCTGGAGGCGGG - Intronic
1161427276 19:4210459-4210481 GGAGGGAGAGAGATGGAGGAGGG - Intronic
1161529165 19:4776803-4776825 GGGAGGCAAGTGAGGGAGGAGGG + Intergenic
1161640781 19:5421393-5421415 TGGGGGAAAGATTTGGAGGAGGG - Intergenic
1161705278 19:5817579-5817601 GGAGGGAAAGAGAGGAAGGAAGG + Intergenic
1162102738 19:8349767-8349789 GGAGGGGAAGGGAAGGAGGAAGG + Intronic
1162450807 19:10753392-10753414 GGGGGGGAAGGGAAGGGGGAGGG - Intronic
1162451632 19:10758493-10758515 GGGAGGAAAGGGAGGAAGGAAGG - Intronic
1163020339 19:14478106-14478128 TGGTGGAAAGTGGTGGAGGCGGG + Exonic
1163298330 19:16427070-16427092 GGCGAGAGAGTGATGGAGGGAGG + Intronic
1163484991 19:17580265-17580287 GGGAAAAAAGAGATGGAGGAAGG - Intronic
1163548541 19:17952680-17952702 GAGGGGACAGAGAGGGAGGAGGG - Intronic
1163966327 19:20750534-20750556 GGAGGACAAGTGATGGAGGAAGG - Intronic
1164521193 19:28981635-28981657 GGGAGGAAGGTGAAGGAGGCGGG + Intergenic
1164591527 19:29510244-29510266 GTGGGGACAGTGATAGAGGACGG - Intergenic
1164656544 19:29925991-29926013 GGGGAGGAAGGGATGGTGGATGG + Intronic
1164953928 19:32364481-32364503 GGGGGGAAAGAGTGGGAGGAGGG - Intronic
1164956668 19:32392362-32392384 GGGAGGAAGGGGAGGGAGGAAGG + Intergenic
1165386125 19:35511649-35511671 GGGTGGAGAGGGAGGGAGGAGGG - Intronic
1165828600 19:38719514-38719536 GAGTGGATAGTGAGGGAGGAAGG + Intronic
1165849374 19:38840387-38840409 GGAAGGAAAGAGAGGGAGGACGG + Intronic
1165987982 19:39787306-39787328 TGGGGGAGTGTGGTGGAGGAAGG - Intergenic
1166040096 19:40197095-40197117 GAGGGTAAACTGATGGAGGCTGG + Intronic
1166040360 19:40198586-40198608 GGGGAGTAAGGGAGGGAGGAAGG + Intronic
1166267967 19:41696654-41696676 AGGGAGAAGGTGATGCAGGAAGG + Intronic
1166297672 19:41896940-41896962 AGGGGGAAGGTGAGAGAGGAGGG - Intronic
1166692736 19:44833496-44833518 GGGGGGGAAGGAAAGGAGGAAGG + Intergenic
1166861840 19:45815781-45815803 GGGGTGAAGGTGGGGGAGGAGGG - Intronic
1166880816 19:45929017-45929039 CAGGGGCAAGTGATGGAGAATGG - Intergenic
1166887975 19:45973196-45973218 GGGGGGGAAAGGATGGAGAAAGG + Intronic
1167073274 19:47232939-47232961 GGAGGGAAAGTGAAAGAGGGAGG - Intergenic
1167195174 19:48023394-48023416 AGGGAGGAAGTGAGGGAGGAGGG + Intronic
1167269144 19:48498274-48498296 GGGGTGACAGTGCTGGAGAACGG - Exonic
1167286589 19:48601849-48601871 GGGAGGAGAGAGATGGAGGCCGG + Intronic
1167295552 19:48646884-48646906 GGGGAGGAGGTGAAGGAGGAGGG + Intergenic
1167338675 19:48902088-48902110 GGGGTGACAGTCAGGGAGGAAGG + Intronic
1167417881 19:49386710-49386732 GGGAGGAAGGGGAGGGAGGAGGG + Intergenic
1167506100 19:49871843-49871865 GGGGGGAAGGTCCTGGAGGGTGG + Exonic
1167579120 19:50331650-50331672 GGAGGGAAAGAGACGGAAGAGGG - Intronic
1167579247 19:50332247-50332269 GGGGGGAGTGTGGAGGAGGATGG - Intronic
1167642871 19:50691430-50691452 GGAGGGAGAAAGATGGAGGAAGG - Intronic
1167717644 19:51154219-51154241 GAGGAGAAGGTGATGGAGAAGGG - Intergenic
1168099990 19:54136280-54136302 GAGGTGAACGTGAAGGAGGATGG - Intergenic
1168128400 19:54300047-54300069 GGGGGGGGAGTGAGGGAGGGAGG - Intergenic
1168148284 19:54431401-54431423 GGGGGGAAAGGGAGGGAGGAGGG - Intronic
1168296152 19:55378147-55378169 GAGGGGGAAGGGACGGAGGAGGG + Exonic
1168357687 19:55712770-55712792 GGTGGGAGAATGAGGGAGGAGGG + Intronic
1168357735 19:55712897-55712919 AGGGGGGAGGAGATGGAGGAGGG + Intronic
1168715558 19:58525155-58525177 GGCCGGGAAGTGATGGAGGGTGG - Intronic
925034252 2:673763-673785 GGGGGGAAGGAGAGGAAGGAGGG + Intronic
925079362 2:1051141-1051163 AGGGGGAGAGGGAGGGAGGAAGG - Intronic
925188838 2:1867059-1867081 GGGGAGAGAGGGAGGGAGGAAGG + Intronic
925189917 2:1874601-1874623 GGGGAGCAGGTGATGGAGGAAGG - Intronic
925750694 2:7088785-7088807 AGGGGCAGTGTGATGGAGGAAGG + Intergenic
925872602 2:8284152-8284174 GGGGTGAAAGTGCTCTAGGAGGG - Intergenic
925902055 2:8515836-8515858 GGGAGGAAGGAGAGGGAGGAGGG - Intergenic
925912503 2:8582933-8582955 AGAGGGAAGGTGGTGGAGGAAGG - Intergenic
926062519 2:9813301-9813323 GGGGGGAGCGTGGGGGAGGAGGG + Intergenic
926269446 2:11354281-11354303 AGGCAGAAAGGGATGGAGGAAGG + Intergenic
926332322 2:11835792-11835814 GGGGGGAAAGAGGTGGAAAAGGG - Intergenic
926733736 2:16057131-16057153 GGGGTGAGAGGGAGGGAGGACGG - Intergenic
926773951 2:16403862-16403884 GGGTGGAAAGAGAAGGTGGATGG - Intergenic
926853577 2:17227787-17227809 GTGGTGAGAGTGATGGAGAACGG - Intergenic
927327903 2:21827591-21827613 TGGGGGAAAGAGAGGGAGGGTGG - Intergenic
927343558 2:22010226-22010248 GAGGGGAAAGGGAAGGGGGAGGG - Intergenic
927448176 2:23184229-23184251 GGGGTGGAAGTGGTGGAGGTGGG - Intergenic
927468242 2:23352527-23352549 AAGGGGAAAGAGAGGGAGGATGG + Intergenic
927659524 2:24981065-24981087 GGGGGGAGAGGGAGGGAGGGAGG + Intergenic
928093447 2:28390526-28390548 GGGGGGAAAGAGGCGGGGGAAGG - Intergenic
928105825 2:28470055-28470077 GGGGAGAAAGAGGAGGAGGAAGG + Intronic
928460483 2:31467797-31467819 GAAGGGAAAGTGTTGGAGAAAGG - Intergenic
928630225 2:33183973-33183995 GGGGAGAAAGTGGAGGAGGGAGG - Intronic
929078788 2:38101205-38101227 GAGGGGAAAGTGGTGCAGTAGGG + Intronic
929097618 2:38278848-38278870 AGAGGGAGAGTGATGGGGGAAGG + Intergenic
929444558 2:41992083-41992105 GGAGGGAAAGTGGGGGAGAAGGG + Intergenic
929616155 2:43310206-43310228 GGCGGGAAAGGGAGGGAGGGAGG - Intronic
929778885 2:44944773-44944795 GAGGGGAAGGAGAGGGAGGAGGG - Exonic
929979446 2:46664953-46664975 GGGGGGAAGGTGAAAGAGCAGGG + Intergenic
930137568 2:47917697-47917719 GTGGGGACAGTGAGGGAGGTGGG + Intergenic
930257063 2:49104843-49104865 GGTGGGAAAGAGATGGGGGGAGG + Intronic
931133390 2:59366219-59366241 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
931145568 2:59513006-59513028 GGGTGGAAAGGGATGGAGGATGG + Intergenic
931196092 2:60053615-60053637 GAGGAGAAAGTGCTGGTGGAGGG - Intergenic
931229893 2:60365357-60365379 GGATGGAGAGGGATGGAGGAGGG + Intergenic
931888344 2:66642788-66642810 GGGGGGGCGGTGATGGGGGAGGG - Intergenic
931996542 2:67844249-67844271 GGAGGGAAAGAGAGGGAGGGAGG - Intergenic
932334402 2:70921726-70921748 GAAGGGAAGGTGATGGAGGGTGG - Intronic
932349985 2:71023882-71023904 GAAGGACAAGTGATGGAGGAAGG + Intergenic
932760388 2:74435922-74435944 GGGTGGATGGTGATGGGGGAAGG - Intronic
932892876 2:75611546-75611568 GGTGGGAAATGGTTGGAGGATGG - Intergenic
932911489 2:75810630-75810652 GGGGAAAAAGGGAGGGAGGAAGG - Intergenic
933018133 2:77157261-77157283 AGGGAGAAAGTGAAGAAGGAAGG + Intronic
933044805 2:77521942-77521964 GGGGGGATAGGGATGGGGGAGGG + Intronic
933355483 2:81205252-81205274 GAGGGGAAAGGGTGGGAGGACGG - Intergenic
933659874 2:84918702-84918724 GGATGGAAACTGATGTAGGATGG + Intergenic
934056111 2:88252971-88252993 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934682985 2:96299007-96299029 GGTGGCAAAGTGATCGAGGCTGG - Intronic
935110673 2:100091776-100091798 ATGGGCAAACTGATGGAGGAAGG - Intronic
935602017 2:104932296-104932318 GGAGGAGAAGGGATGGAGGAGGG + Intergenic
935755739 2:106275127-106275149 GGGGGCAGAGTGAGGGTGGATGG + Intergenic
936124298 2:109773386-109773408 ATGGGCAAACTGATGGAGGAAGG + Intergenic
936220391 2:110598078-110598100 ATGGGCAAACTGATGGAGGAAGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
937249615 2:120515232-120515254 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937249620 2:120515249-120515271 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937249709 2:120515624-120515646 GGAGGGAGAGTCAGGGAGGAGGG - Intergenic
937901101 2:127019782-127019804 GGGAGGGAAGAGAAGGAGGAAGG + Intergenic
938166903 2:129037898-129037920 GGGGGTGAGGTGCTGGAGGAGGG - Intergenic
938378912 2:130825814-130825836 GGGGAGAAAGGGGTGGAGGCAGG - Intergenic
938585399 2:132685645-132685667 GGTGGGAATGTGAGGGAAGAGGG - Intronic
938875787 2:135530690-135530712 GGGAGAGAAGTGATGGAAGAAGG - Intronic
939202031 2:139048262-139048284 GGAGGGAAAGAGAAGGAGGGGGG + Intergenic
939532498 2:143382089-143382111 GGAAGGAAAGGGAGGGAGGAAGG - Intronic
939771593 2:146326719-146326741 GAGAGGAAAGACATGGAGGAGGG + Intergenic
939953856 2:148508468-148508490 GGGGGGAAGGTGAGGGAAAATGG + Intronic
940057882 2:149532354-149532376 AGGGGGAAAGTGATGGCGCTGGG + Intergenic
940337782 2:152546921-152546943 TGGGGGCAAGTAATGCAGGATGG - Intronic
940340728 2:152578051-152578073 CGAGGGAATGGGATGGAGGAAGG + Intronic
940797717 2:158098259-158098281 GGGGTGAAAATAAAGGAGGAGGG + Intronic
940874448 2:158885653-158885675 GAAGGACAAGTGATGGAGGAAGG + Intergenic
940968605 2:159869149-159869171 TGGGGCAGAGTGATGGGGGAGGG + Intronic
941179466 2:162240806-162240828 GGCAGGAAAGGGAAGGAGGAAGG - Intronic
941381849 2:164802836-164802858 GGAGGGAAAGAGAGGGAGGAAGG + Intronic
941413750 2:165193144-165193166 TGGAGGAGAGTGATGGAGTAGGG - Intronic
941492102 2:166155043-166155065 GGGGGGAGAGGGAGGGAGGGAGG + Intergenic
941764509 2:169281983-169282005 AGGGGAATAGTTATGGAGGAAGG + Intronic
942878179 2:180827562-180827584 GGGGTGAGAGTGAGGGAGGGTGG + Intergenic
942978662 2:182051083-182051105 TGGAGGAAATTGATGGAGAAAGG + Intronic
943532662 2:189103864-189103886 AGGAAGAAAGTGAGGGAGGAAGG - Intronic
943699259 2:190972053-190972075 GGGGGTAAAGAGAGGGAGGGAGG + Intronic
944900797 2:204214120-204214142 GGGGGGAAAGAGAGAGAGAAAGG - Intergenic
945015397 2:205509610-205509632 GTAGGGATAGTGAAGGAGGAGGG + Intronic
945028955 2:205645805-205645827 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
945057457 2:205881180-205881202 GGGAGGAAAGGGAGGGAGGGAGG + Intergenic
945276918 2:207997374-207997396 GGAAGGAAAGAGATGGAGGAGGG + Intronic
945599698 2:211845242-211845264 GTGGGGATAGTGATGGAGCGTGG - Intronic
946422668 2:219573513-219573535 GAGGGGGAAGAGAAGGAGGAGGG - Intronic
946553021 2:220823653-220823675 GGGAGGAAAGGGAGGGAGGAAGG - Intergenic
946553061 2:220823770-220823792 GGAAGGAAAGGGAGGGAGGAAGG - Intergenic
946609256 2:221440152-221440174 GGGAGGAAAGGGGTGGGGGAAGG + Intronic
946716129 2:222556664-222556686 GGGGGAAGAGTGAAGGTGGAGGG - Intronic
946890141 2:224267046-224267068 GGGGAAAAAGAGATGGAGAAAGG - Intergenic
946894842 2:224313035-224313057 GGGGATAAAGTTATGGAGGAAGG - Intergenic
946980727 2:225212532-225212554 AGGGAGAAAGAGATGGAGGTGGG + Intergenic
946992731 2:225353394-225353416 GGGGGGAAGATGAAGGAGAAAGG + Intergenic
947030063 2:225783050-225783072 AGTGGGAAAGTGAGGAAGGAAGG - Intergenic
947030110 2:225783210-225783232 AGGGGGAAAGGGAGGGAGGGAGG - Intergenic
947472830 2:230414090-230414112 GGGGAGGCAGTGATTGAGGAAGG - Intergenic
947960898 2:234236351-234236373 GGGTGGAAAGGGAGGGAGGAAGG - Intergenic
948024947 2:234769365-234769387 GTGGGGCAGGTGATGGAGGGAGG - Intergenic
948230252 2:236344059-236344081 TGGGGGGAAGTGGTGGAGGAGGG + Intronic
948256372 2:236571364-236571386 GGTGGGAAAGCGAAGGAAGATGG + Intronic
948319825 2:237060458-237060480 GTGGGGAAAGTGAGAGACGATGG + Intergenic
948342549 2:237266435-237266457 GGGGAGGAGGAGATGGAGGAGGG - Intergenic
948458425 2:238117972-238117994 GAGGAGAAATAGATGGAGGAAGG + Intronic
948577761 2:238965369-238965391 GGGAGGAGAGGGAGGGAGGAGGG - Intergenic
948698582 2:239746820-239746842 CGGGGGAAGGTGAGGTAGGATGG + Intergenic
948735062 2:239998229-239998251 AGGAGGAAAGTGAAGGAGGGAGG - Intronic
948875533 2:240825337-240825359 GGGGGGAGAGAGAGAGAGGAGGG - Intergenic
1168819869 20:765577-765599 GGGCCGGAAGTGATGGAGCAGGG + Exonic
1168965285 20:1894850-1894872 GAGGGGAAAGGGAAGGAGGGAGG + Intronic
1169231050 20:3889203-3889225 GGGGAGAGGGTGGTGGAGGAGGG - Exonic
1169525997 20:6426319-6426341 GGAGGGAGAGAGAGGGAGGATGG - Intergenic
1169788162 20:9382707-9382729 GGGAGGAAGGTGATGAAGCATGG - Intronic
1170173577 20:13442118-13442140 GGGGGGAAAGGGAGCCAGGAAGG - Intronic
1170345960 20:15387488-15387510 GGGGGAAAAGGAATGGAGAAGGG - Intronic
1170423917 20:16219305-16219327 GGAGGGAAAGTGTTGAAAGAGGG - Intergenic
1170555802 20:17513769-17513791 AGTGGGAAAGTGAGGCAGGAAGG + Intronic
1170888829 20:20363174-20363196 GGGGGGAGAGTAAAGGAGGGGGG + Intergenic
1171012050 20:21514133-21514155 GGGGAGAAAGAGAGGGAGGGAGG + Intergenic
1171107108 20:22445040-22445062 GGTGGGAATGAGATGGAGGTAGG + Intergenic
1171139678 20:22729919-22729941 GTGTGGAAAGTCATGGAGGAGGG + Intergenic
1171290794 20:23981849-23981871 GGTGGGAAAGAGCTGCAGGAGGG - Intergenic
1172292181 20:33784246-33784268 GGGGGGAGAGAGATGGAGAGAGG - Intronic
1172302218 20:33858136-33858158 GGGAGGAAAGGGAAGGAGGAAGG + Intergenic
1172325247 20:34029471-34029493 GGGAGGAAAGGGAGGGAGGGAGG + Intronic
1172475279 20:35232599-35232621 GGGAGGAGAATGATGGAGAAGGG + Intronic
1172931214 20:38587699-38587721 GGTGGGTAAGTGATGGGGGTGGG - Intronic
1173002038 20:39111628-39111650 GGAGGGAAAGGGGAGGAGGAAGG + Intergenic
1173049699 20:39547289-39547311 GGGGGGAAAGTGATGACTCAAGG - Intergenic
1173169867 20:40715420-40715442 CGGGGCACAGTGATGGAGCACGG - Intergenic
1173418045 20:42876049-42876071 AGGGAGAGAGTGAAGGAGGATGG - Intronic
1173792014 20:45834026-45834048 GGGGGGAAAGCGATGCTGGCTGG + Intronic
1173857561 20:46260498-46260520 ACGGGGAAAGGGATGGAAGAAGG - Intronic
1173902336 20:46600235-46600257 AGGGAGAGAGAGATGGAGGAAGG + Intronic
1174042258 20:47708361-47708383 AGGGGGACAGTGAGGGAGGGAGG + Intronic
1174301341 20:49584775-49584797 GGGGAGAAAGCAATGGAGGAGGG + Intergenic
1174561752 20:51435607-51435629 TGGGGGACACTGATGAAGGAAGG + Intronic
1174582208 20:51579922-51579944 GGAGGGAAAATGATGGAGTAGGG - Intergenic
1175191910 20:57217053-57217075 AAGGGGAAAGGGATGGAGGCAGG + Intronic
1175356794 20:58375127-58375149 GGAGAGAGAGAGATGGAGGAAGG - Intergenic
1175369941 20:58481527-58481549 GAGGAGAGAGGGATGGAGGATGG + Intronic
1175487384 20:59355720-59355742 GGGGGGAGAGGGACAGAGGAGGG - Intergenic
1175487392 20:59355740-59355762 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487401 20:59355761-59355783 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175487409 20:59355781-59355803 GGGGGGAGAGGGAGAGAGGAGGG - Intergenic
1175676404 20:60949883-60949905 GGGGAGAAAGGGATGGAGGTAGG + Intergenic
1175733627 20:61370915-61370937 CGGGGGAAAGGGAGGGAGAAAGG - Intronic
1175918952 20:62441083-62441105 GGGAGGGAAGCCATGGAGGATGG + Intergenic
1175921395 20:62452000-62452022 GGGGGGAGAGAGATGGGGGAGGG + Intergenic
1175934859 20:62509892-62509914 GAGGGCGAAGGGATGGAGGATGG - Intergenic
1176077997 20:63257525-63257547 CGGAGGACAGTGATGGAGAACGG + Intronic
1176078015 20:63257645-63257667 TGGAGGACAGTGATGGAGAACGG + Intronic
1176270389 20:64233154-64233176 GGAGGGAAAGGGAAGGAGGAAGG - Intronic
1176513702 21:7767452-7767474 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1178006606 21:28227400-28227422 AGAGGGAAAGAGAGGGAGGAAGG + Intergenic
1178647815 21:34397976-34397998 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1178887695 21:36496712-36496734 GGGGAGGAAGGGAGGGAGGAAGG + Intronic
1179311080 21:40196649-40196671 GAGGGGAAAGTGAAGAAGGAAGG - Intronic
1179405359 21:41121364-41121386 GGGGGGTAAGTGATAAAGGTGGG - Intergenic
1179635602 21:42706770-42706792 GGGGTGAAGGGGATGGAGGGGGG - Intronic
1180339275 22:11605484-11605506 AGGGAGAAAGCGATGGAGGGAGG - Intergenic
1180613973 22:17115740-17115762 GGGGCAAGAGTGATAGAGGAGGG + Intergenic
1181382871 22:22520863-22520885 GAGGGGGTAGTGAAGGAGGAGGG - Intergenic
1181460437 22:23083043-23083065 GTTGGGAGAGTGAAGGAGGAGGG + Intronic
1181528259 22:23502239-23502261 TGGGGGATAGGGATGGGGGATGG - Intergenic
1181774183 22:25147952-25147974 GGGAGGAAAGGAAAGGAGGAAGG - Intronic
1181975064 22:26723054-26723076 AAGGGGAAATGGATGGAGGAGGG - Intergenic
1181998611 22:26902773-26902795 GGGGGGAAAGAGAGAGAGGAAGG - Intergenic
1182354558 22:29716724-29716746 GGGGAGAAGGTACTGGAGGAGGG - Intergenic
1182410423 22:30180807-30180829 GGGGGGAAAGGAAGGGAAGAAGG - Intergenic
1182656746 22:31896751-31896773 GAGAGAAATGTGATGGAGGAGGG - Intronic
1182740227 22:32562267-32562289 GGTGGGAAAGGGCGGGAGGAAGG - Intronic
1183024254 22:35052303-35052325 GGAGGGAAAGGGATGGGGGGTGG - Intergenic
1183090699 22:35519960-35519982 GGGAGGGAAATGATGGAGGTGGG + Intergenic
1183097357 22:35561143-35561165 GGGGGGAGAGGGATGGATTAGGG - Intergenic
1183102599 22:35593114-35593136 TGGGGGAGAGGGATGGAGGTGGG + Intergenic
1183147179 22:36004154-36004176 TGGGAGAAAGTCATGGAGGTTGG - Intronic
1183231354 22:36584107-36584129 GAGTGGAGAGTGATGGGGGAGGG - Intronic
1183848426 22:40562630-40562652 AGGGGGAAAGGGGGGGAGGAGGG + Intronic
1184105039 22:42362519-42362541 GGCGAGAAAGTGGAGGAGGAAGG + Intergenic
1184449764 22:44575977-44575999 GGGGAGAAAGAGGAGGAGGAGGG + Intergenic
1184451657 22:44586175-44586197 GGGGTGACAGTGACTGAGGAGGG - Intergenic
1184855436 22:47144022-47144044 GGGTGCAGAGTGCTGGAGGAGGG - Intronic
1184959365 22:47917906-47917928 GGGAGGAAGGAGAAGGAGGAAGG - Intergenic
1184959375 22:47917940-47917962 GGGAGGAAAGAGAGGGAGGAGGG - Intergenic
1185150236 22:49160032-49160054 TGGGGGAAAGGGCTGGAGGGTGG + Intergenic
1185222087 22:49634209-49634231 GAGGTGGAAGTGCTGGAGGAGGG - Intronic
1185279093 22:49962330-49962352 GGGGAGAGAGGGAGGGAGGAGGG - Intronic
949686812 3:6583277-6583299 TGGGGGAAATTGCTGGAGGGAGG + Intergenic
949884603 3:8683239-8683261 GAAGGACAAGTGATGGAGGAAGG + Intronic
950344077 3:12276230-12276252 GGGAGGAAAGGAAGGGAGGAAGG + Intergenic
950464388 3:13144683-13144705 GGGAGCCACGTGATGGAGGAGGG - Intergenic
951666300 3:25127623-25127645 GGGAGGAGAGTGATGGGGAAAGG + Intergenic
951959444 3:28300622-28300644 GGAGGGAAAGGGATGGAGGGAGG - Intronic
951959451 3:28300640-28300662 GGAGGGAAAGGGATGGAGGGAGG - Intronic
952400782 3:32961347-32961369 GGGTGGTAAGAGATGGAGCAGGG + Intergenic
952428068 3:33195398-33195420 GGGGAGAAACTGCTGGGGGATGG + Intronic
952496367 3:33919383-33919405 TGGAGGAATGGGATGGAGGAGGG + Intergenic
953463177 3:43097501-43097523 AGGGGGAAAGGGAGGGAGAAAGG + Intronic
953477187 3:43215475-43215497 GGAGGAAAAGAGATGGAGAAGGG + Intergenic
953635564 3:44660911-44660933 AGAGGGAAAGTGATGGGAGAGGG + Intergenic
954749152 3:52804010-52804032 GTGGGGATAGGGATGGAGGCCGG + Intronic
954876528 3:53806194-53806216 GGAGGGAAGATGAGGGAGGAGGG - Intronic
955005374 3:54963833-54963855 TGGGAGAAAGGAATGGAGGAAGG + Intronic
955809988 3:62777619-62777641 TGGGGGAAACTGTTGGAGGTAGG + Intronic
955932688 3:64073509-64073531 TTTGGCAAAGTGATGGAGGATGG + Intergenic
956289575 3:67647423-67647445 TGGGGGATGGTGTTGGAGGATGG - Intronic
956313954 3:67913816-67913838 AGGGGAAAAGGGAAGGAGGAGGG - Intergenic
956472656 3:69584315-69584337 GGGAGGAAAGAGAAGGAGAAGGG - Intergenic
956795812 3:72717585-72717607 GGGAGGGAATTGTTGGAGGATGG + Intergenic
957370124 3:79283218-79283240 GCTGGGAGAGGGATGGAGGAGGG + Intronic
957375519 3:79352189-79352211 TGCTGGAAAGTCATGGAGGAAGG + Intronic
957593784 3:82233937-82233959 AGGGAGAAAGAGAGGGAGGAAGG + Intergenic
958082356 3:88762566-88762588 GGAGGGCAAGGGAGGGAGGAGGG + Intergenic
959273807 3:104250204-104250226 GTGTGGAAATTGATGGAGCAAGG - Intergenic
959274828 3:104265431-104265453 TGGGGGAAAGAGTTGGAGGGGGG - Intergenic
959434538 3:106298190-106298212 GGAGAGAAAGAGAGGGAGGAGGG - Intergenic
959479164 3:106850166-106850188 GGGGAGAAAGAGAGGGATGAAGG + Intergenic
959959118 3:112276016-112276038 GGGGGCTAAGTGATCCAGGATGG - Intronic
960452069 3:117822305-117822327 TGGGGGAAAGGGAGGGAGGAAGG + Intergenic
960822865 3:121752891-121752913 GGGGGGAAAAAGAAGAAGGAAGG + Intergenic
961066211 3:123879468-123879490 GGGGCTAGAGTGATGCAGGAAGG - Intronic
961275152 3:125720558-125720580 GAAGGACAAGTGATGGAGGAAGG + Intergenic
961278069 3:125743181-125743203 GAAGGACAAGTGATGGAGGAAGG + Intergenic
961349870 3:126292940-126292962 GGGGAAAAAGTGATGGACTAAGG + Intergenic
961660268 3:128464929-128464951 AGGGGGAAGGGGAGGGAGGAAGG - Intronic
961705812 3:128784368-128784390 GGGGAGAAAGTAAAGGTGGATGG - Intronic
961737354 3:129010513-129010535 GGTGGGAGAGGGAGGGAGGAGGG + Intronic
961876342 3:130026475-130026497 GAAGGACAAGTGATGGAGGAAGG - Intergenic
961892802 3:130144621-130144643 AGAGGACAAGTGATGGAGGAAGG - Intergenic
961946205 3:130691552-130691574 GTGTGGAGAGTAATGGAGGAGGG - Intronic
962013505 3:131417268-131417290 TGGGGGAAAGAGTGGGAGGAGGG + Intergenic
962072240 3:132044755-132044777 GGAGGGAGGGTGATGGAGGGAGG + Intronic
962239819 3:133743021-133743043 GGGAGGAAAGAGAGGGAGGGAGG - Intergenic
962386362 3:134935712-134935734 GGGTGGCAACTGATGAAGGAGGG + Intronic
962678625 3:137775717-137775739 GGTAGGAAAGTGATGGCGAAGGG + Intergenic
963240994 3:143002097-143002119 GGAGGGAAACTGAGGGAGGCCGG - Intronic
963284223 3:143417486-143417508 GGGGGGAGAGGGAGGGAGGAGGG + Intronic
963284230 3:143417507-143417529 GGGGAGAAAGGGATGGATGGAGG + Intronic
963846157 3:150159869-150159891 AGGGGGAGAGTGAGGGAGGTGGG + Intergenic
964500118 3:157339648-157339670 TGGAGGAAAGTGATAGAGGGTGG + Intronic
964739747 3:159952926-159952948 GGGTGGAAAGTGATGGACAAGGG + Intergenic
965190284 3:165519123-165519145 GTGTGGAAAATGATGGAAGATGG - Intergenic
965836399 3:172858000-172858022 GGAGTGAAACTGATGCAGGAGGG + Intergenic
966142256 3:176769616-176769638 GGGAGGAAAGGGAGGGAGGGAGG + Intergenic
966429956 3:179820876-179820898 GTAGGGAAAGAGATGGAGGGTGG + Intronic
966461403 3:180180625-180180647 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
966588215 3:181650995-181651017 GAGGGGAGAGGGAAGGAGGAAGG + Intergenic
966600986 3:181774797-181774819 GGGGGGATAGTGTGGGAAGAGGG + Intergenic
967427857 3:189348127-189348149 GGGAGGAGACTGCTGGAGGAAGG + Intergenic
967723232 3:192837404-192837426 GGTGGGACAGGGGTGGAGGATGG - Intronic
967833623 3:193942980-193943002 GCGAGGCAAGTGAGGGAGGAAGG + Intergenic
967909269 3:194527837-194527859 GGGAGGGAAGGGAAGGAGGAAGG - Intergenic
968042296 3:195598880-195598902 TGGGTGAAAATAATGGAGGAGGG + Intergenic
968208890 3:196830025-196830047 GGGGGGAAGTTAATGGGGGAAGG - Exonic
968283408 3:197493979-197494001 GGAGGGAAAGGGAGGAAGGAAGG - Intergenic
968818355 4:2833181-2833203 GGGGGGTGAGCGATGGTGGAGGG - Intronic
968862815 4:3185955-3185977 GGGAGGAAGGGGAGGGAGGAAGG + Intronic
968988612 4:3893681-3893703 GAAGGACAAGTGATGGAGGAAGG - Intergenic
968991650 4:3917361-3917383 GGGGAGAAAGGGAGGGAGGGAGG + Intergenic
968991662 4:3917385-3917407 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
969019594 4:4130924-4130946 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969024297 4:4161324-4161346 GAAGGACAAGTGATGGAGGAAGG - Intergenic
969345919 4:6569947-6569969 GGAAGGAAGGAGATGGAGGAAGG + Intergenic
969481570 4:7449282-7449304 GGGGAGGAAGGGAGGGAGGAAGG - Intronic
969729520 4:8945840-8945862 GAAGGACAAGTGATGGAGGAAGG + Intergenic
969734262 4:8976495-8976517 GCAGGACAAGTGATGGAGGAAGG + Intergenic
969749964 4:9102520-9102542 GGAGGACAAGTGATGGAGGAAGG + Intergenic
969789106 4:9479780-9479802 GAAGGACAAGTGATGGAGGAAGG + Intergenic
969793844 4:9510548-9510570 GAAGGACAAGTGATGGAGGAAGG + Intergenic
970011785 4:11467638-11467660 GGGGTGAAAGGGAAGAAGGAAGG + Intergenic
970027341 4:11637338-11637360 GTGGGGAAGGTGCTGGTGGAAGG - Intergenic
970188134 4:13484185-13484207 GGGGGGGAAGGGAAGGATGAAGG + Exonic
970450151 4:16158299-16158321 TGGGGAAACGAGATGGAGGATGG - Intergenic
970607243 4:17692189-17692211 GAGGGAGAAGTGAAGGAGGAGGG + Intronic
971260048 4:25048275-25048297 CGGGGGAAAGTGTGGGAGGGCGG - Intergenic
971393747 4:26209758-26209780 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971393765 4:26209807-26209829 GGGGGGAGAGGGAAGGAGGAAGG - Intronic
971861199 4:32108273-32108295 AGGGGGAAAGGAATGAAGGAGGG + Intergenic
971884901 4:32432076-32432098 GGGTGGAAAGAGAGAGAGGAGGG - Intergenic
972114834 4:35618912-35618934 GGAAGGAAACTGATGGAGTAAGG - Intergenic
972142073 4:35973273-35973295 GGAGGGGAAGGGAGGGAGGAAGG + Intronic
972142088 4:35973322-35973344 AGGGGGAAAGGGAGGGAGGCAGG + Intronic
972335673 4:38105582-38105604 GGGTGGAGAGGGAGGGAGGAAGG - Intronic
972489084 4:39569925-39569947 GGGAGGAAACTAATGGAGTAAGG - Intronic
972698623 4:41472359-41472381 GGAAGGAAAGAGAGGGAGGAAGG - Intronic
972732225 4:41806188-41806210 GAGGGGAAGGTGATGGATGGAGG + Intergenic
972790245 4:42364909-42364931 GGAGGGAAAGAGAAAGAGGAAGG - Intergenic
972827321 4:42774732-42774754 GTGGGGAAAGTGTAGGAGGTGGG + Intergenic
973147763 4:46849203-46849225 GGGGAGAAACTGATGGCGCAAGG - Intronic
973288891 4:48449788-48449810 GGGAGGAAAGGCAGGGAGGACGG - Intergenic
973766543 4:54168266-54168288 GGGGGGACAGGGAGAGAGGAGGG + Intronic
973920570 4:55680894-55680916 TGGGGGAAAGGGTGGGAGGAAGG + Intergenic
974011458 4:56611421-56611443 GGGGGGAAAGTGTGGGAAGCGGG + Intergenic
974859552 4:67502997-67503019 GGGGTTGAAGGGATGGAGGAAGG - Intronic
975360226 4:73460955-73460977 GGGGGGAGGGGGATGGGGGAGGG - Intergenic
975362356 4:73485692-73485714 GGGGGGGAAGGGAAGGAGAAGGG + Intronic
975691749 4:76972116-76972138 GGGGGGCAGGTAGTGGAGGAAGG - Intronic
976231199 4:82845106-82845128 GGGGTGAAAGAGCTTGAGGAAGG + Intronic
976442857 4:85096158-85096180 AGGGGGAAAGAAATGGAAGAAGG - Intergenic
976616789 4:87086413-87086435 GGGTGGGAAGGGAAGGAGGACGG - Intronic
976695821 4:87918779-87918801 GGAGGGAAAGGGAGGGAGGGAGG + Intergenic
977213710 4:94252855-94252877 GGTGAAGAAGTGATGGAGGATGG + Exonic
977726322 4:100300870-100300892 GGGATGAAAGTGAGGGAGGTAGG + Intergenic
978490171 4:109303271-109303293 TGTGGGAAAGTGAGGGAGGAGGG - Intergenic
978497505 4:109376113-109376135 GGTAGGAAAGTGTTTGAGGATGG - Intergenic
978620481 4:110631560-110631582 GGGGTGTAAGGGATGGAGGAGGG - Intronic
979866404 4:125760387-125760409 GGGGAGGAAGTGAGGGAAGAGGG + Intergenic
979972894 4:127159601-127159623 GGGGGAAAGGAGATGGAGGAAGG + Intergenic
980092331 4:128455623-128455645 GAGGGGGAAGGGAAGGAGGAAGG + Intergenic
980505199 4:133710008-133710030 GGGGGGAAAGGGAGGGAAGGTGG + Intergenic
981034594 4:140156377-140156399 TGGAGGCAAGTGAAGGAGGAGGG - Intergenic
981182632 4:141763811-141763833 TGGGGCCAGGTGATGGAGGATGG + Intergenic
981413343 4:144458767-144458789 GGGGAGGAAGGGAGGGAGGAAGG + Intergenic
981731175 4:147900776-147900798 GGGTGGAAAGGGAGGAAGGAGGG - Intronic
982179115 4:152733518-152733540 AGGGGGAAACTGATGAAGAAAGG + Intronic
982534466 4:156592502-156592524 GAGGGGAAGGTGATGGAGATAGG - Intergenic
982959676 4:161821564-161821586 TGGGGGTAAGTGTGGGAGGAGGG - Intronic
983197753 4:164826443-164826465 GGGGGGAGAGAGAGGAAGGAAGG + Intergenic
983281010 4:165680862-165680884 CAGGGGATAGTGATGAAGGACGG + Intergenic
983576482 4:169266619-169266641 GGGGGGCAGGGGATGGGGGAGGG + Intronic
984443026 4:179797322-179797344 AGGGAGAAAGTGAGGGAGGGAGG + Intergenic
984514089 4:180716964-180716986 GAGTGCAAGGTGATGGAGGATGG + Intergenic
984607652 4:181804026-181804048 GGAGGGTAAGGGAAGGAGGAAGG + Intergenic
984607676 4:181804117-181804139 GGAGGGAAAGGGAGGGAGGGAGG + Intergenic
984703495 4:182833193-182833215 GAGGGGAGAGAGAAGGAGGAGGG - Intergenic
985006509 4:185539943-185539965 GAGGGGATAGGGATGGAGCAAGG + Intergenic
985095594 4:186409507-186409529 GGGGAGGAAATGAGGGAGGAGGG + Intergenic
985250896 4:188023380-188023402 GGGGGGATGGTGGTGGAGGGAGG + Intergenic
985756652 5:1723479-1723501 GAGGGGAAAGGGAGAGAGGAAGG - Intergenic
986463034 5:7992878-7992900 GGAGGGTAAGTGAGGGAGGAAGG + Intergenic
986517243 5:8576438-8576460 GAGGGGAAGGTGATTGAGGGAGG - Intergenic
987614524 5:20255132-20255154 GGAGGGAAGGAGAGGGAGGATGG + Intronic
988548198 5:32176710-32176732 GGGGAAGAAGTGAGGGAGGAAGG + Intergenic
988588980 5:32532570-32532592 GAGGGGAAGGTAATGGAGAAGGG + Intronic
989016934 5:36947387-36947409 GGGGAGAAAGAGACAGAGGATGG - Intronic
989069658 5:37497260-37497282 GAGGGAAAAGGGAGGGAGGAAGG - Intronic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
989378225 5:40787756-40787778 AGGGGGAAAGTAATAGAGAAAGG + Intronic
989997182 5:50849741-50849763 GGGGGCAAAGTACAGGAGGAAGG - Intergenic
990090187 5:52035409-52035431 GCAGGGAAAGCGATGGAGGAGGG + Intronic
990426213 5:55691780-55691802 GGGGGAAAACTGGTGGGGGAGGG + Intronic
990485638 5:56257284-56257306 GGGGAGGAAGGGAGGGAGGAGGG - Intergenic
990673159 5:58155184-58155206 TGGGGGGAAGTGTGGGAGGAGGG + Intergenic
990820977 5:59840031-59840053 AGGGGGAAAGTGTTGGAAGATGG - Intronic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
991433572 5:66573305-66573327 GGAGGGAAAGGGAGGGAGGGAGG + Intergenic
991445578 5:66696468-66696490 GGGTGAAAGGTGAGGGAGGAAGG - Intronic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
992258322 5:74944528-74944550 TGAGGGAAAGTGAAGGAAGATGG + Intergenic
992924543 5:81567983-81568005 GGAAGGAACTTGATGGAGGAAGG + Intronic
993334718 5:86644095-86644117 TGGGGGCAAGGGATGGGGGAAGG - Intergenic
993375063 5:87141090-87141112 AGGGGGAGAGGGAGGGAGGAAGG + Intergenic
993461724 5:88190450-88190472 GGAGGACAAGTGATGGAGGAAGG - Intronic
993478057 5:88389066-88389088 GCGGGGAGAGTGAAAGAGGAGGG + Intergenic
993654296 5:90558751-90558773 GGGGAGAAAGGGGAGGAGGATGG + Intronic
993696697 5:91070104-91070126 GATGGGAAAGGGATGGAGGGGGG + Intronic
993752411 5:91687208-91687230 GGGGTGAGAGTGATGGAGGAGGG + Intergenic
993900734 5:93582889-93582911 GGAGAGAAAGTGAGGGAGGGGGG - Intergenic
994324317 5:98431774-98431796 GGGGGCAAAGAGATGGGGGTAGG - Intergenic
994681930 5:102899035-102899057 GGAGGGAAAGGAAGGGAGGAAGG - Intronic
994731009 5:103490557-103490579 GGGAGGAAAGTAAGGAAGGAGGG - Intergenic
994731047 5:103490675-103490697 GGAGGGAGAATGAAGGAGGAGGG - Intergenic
995813931 5:116144908-116144930 GGGGAGAAAATGATGCAGAATGG + Intronic
996629600 5:125611646-125611668 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
996629607 5:125611668-125611690 GGGGAGAAAGAGAGGGAGGTAGG + Intergenic
996885958 5:128353981-128354003 GGGGAGACAGGGAGGGAGGATGG - Intronic
997010033 5:129865808-129865830 GGGAGAAAAGAGATGGAGGGAGG + Intergenic
997522667 5:134533178-134533200 GGTCGGAAAGTCCTGGAGGAGGG - Intronic
998173424 5:139885724-139885746 GGGGGGAATGTGCGGGAGGGAGG + Intronic
998182186 5:139953474-139953496 GGTGGGAAGGGGTTGGAGGATGG - Intronic
998367167 5:141638982-141639004 TGGGGGACAGTGAAGGAGAAGGG + Exonic
998371742 5:141666385-141666407 GGGGGGACAGGGATGAAGGGTGG - Intronic
998600687 5:143581865-143581887 GGGAGGAGAGTGAGGGAGGGAGG + Intergenic
999068024 5:148712882-148712904 GGGTGGAAAGTGTTGGAGAGAGG + Intergenic
999155266 5:149453390-149453412 GGGGAGGCAGGGATGGAGGACGG - Intergenic
999194277 5:149771416-149771438 GGGAGGGAACTGCTGGAGGAGGG + Intronic
999240139 5:150122766-150122788 GGGCAGGCAGTGATGGAGGAAGG - Intronic
999309360 5:150541829-150541851 GAGGGGAAAGAGGTGGAGGAGGG + Intronic
1000137220 5:158364597-158364619 GGCGGGAAAGTGAAGAGGGAAGG - Intergenic
1000618940 5:163460746-163460768 AGGGGGAAAGAGCTGGGGGACGG + Intronic
1001020243 5:168176561-168176583 GGCTGGACAGTGATGAAGGAGGG - Intronic
1001089433 5:168726461-168726483 GGAGGGAGAGGGAGGGAGGAAGG + Intronic
1001545982 5:172570805-172570827 GAGGGGAAAAGGAAGGAGGAAGG + Intergenic
1001634314 5:173198824-173198846 AGGGAGAAAGGGAGGGAGGAAGG - Intergenic
1001959349 5:175871157-175871179 TGGGGGCAAGGGGTGGAGGAAGG - Intronic
1002184676 5:177448596-177448618 TGGAGGAAAGTGAAGGAAGAAGG - Intronic
1002211249 5:177600482-177600504 GGGGGGAAGGTGCTGGGGGAAGG - Intronic
1002447129 5:179296472-179296494 GGCAGGAAAGTAAGGGAGGAGGG + Intronic
1002493141 5:179593924-179593946 GGAGGGACAGTGAAGGTGGATGG - Intronic
1003123640 6:3338084-3338106 TGGGGGAAACTGATGGAAGACGG - Intronic
1003153134 6:3569912-3569934 GAGGGGAGAGGGAGGGAGGATGG - Intergenic
1003162924 6:3651327-3651349 GGGGGAAAAGGGAGGGAGGAGGG + Intergenic
1003235787 6:4294446-4294468 GGGGGCAAGGTGAGGGAGGGAGG - Intergenic
1003481492 6:6537575-6537597 GGGGGGAAAGGGAAGGGGGGAGG + Intergenic
1003878826 6:10462131-10462153 GGGAGGGAAGGGAGGGAGGAAGG + Intergenic
1004061710 6:12204381-12204403 CGGGGGAAAGGGAGGGAGAAAGG - Intergenic
1004721030 6:18267209-18267231 GAGGGGAAAGTGCAGGAGGTGGG + Intergenic
1004748661 6:18538556-18538578 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1004790332 6:19018989-19019011 GGGTGGAAAGTAAAGGAAGAAGG + Intergenic
1004945601 6:20609326-20609348 GAGGGAAAAGAGAGGGAGGAGGG - Intronic
1005064899 6:21808354-21808376 GGAGGGAGAGAAATGGAGGAGGG - Intergenic
1005168923 6:22958691-22958713 TGGGGGAAACAAATGGAGGAAGG - Intergenic
1005205537 6:23399282-23399304 GGAGGGAAAGGGTGGGAGGAGGG - Intergenic
1005272949 6:24185853-24185875 GGAGTGAAGGGGATGGAGGAAGG - Intronic
1005277186 6:24231567-24231589 GTGGTGATAGTGGTGGAGGATGG - Intronic
1005674640 6:28141538-28141560 GCTGGGAAAGTGTTGGAGGAGGG - Intergenic
1005779152 6:29170089-29170111 GGGGGGCAGGGGATGGAGAAAGG + Intergenic
1006107392 6:31724735-31724757 GGGGGGACAGAGCTGAAGGATGG - Intronic
1006113383 6:31762262-31762284 AAGGGCAAAGTGCTGGAGGAAGG - Intronic
1006188301 6:32192522-32192544 GGGGAGAAACTGGTGGGGGAGGG + Exonic
1006245221 6:32728033-32728055 AGGGAGAAAGAGAGGGAGGATGG - Intergenic
1006390801 6:33757187-33757209 GGTGGGGAGGTGAGGGAGGAGGG - Intergenic
1006857863 6:37148208-37148230 GGGGGTAAAATGTTGGAGGTGGG + Intergenic
1006909456 6:37554790-37554812 GGGGGGAGAGAGGTGGAGGTGGG + Intergenic
1007407893 6:41645271-41645293 GGGGGAAAAGGGATGGGGGATGG - Intronic
1007636056 6:43300478-43300500 GGAGGGAATGAGATGAAGGAGGG - Intronic
1007741045 6:44009636-44009658 AGGGAGAAAGGGAGGGAGGAAGG + Intergenic
1007905480 6:45455680-45455702 GGGTGGAAGGTGAAGGAGCAAGG + Intronic
1008092615 6:47308832-47308854 GAGGGTAAAGGGATTGAGGAGGG + Intronic
1008713179 6:54254768-54254790 GGGGGGGAAGGGAGGGAGGAAGG - Intronic
1008920931 6:56843689-56843711 GGGGAGAGAGGGAGGGAGGAGGG + Intronic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1009828433 6:68897754-68897776 GGAGGAAAAGGGAGGGAGGAAGG + Intronic
1010180888 6:73085490-73085512 GGGGAGAAAGTTATTGAGGCTGG + Intronic
1010458689 6:76088064-76088086 TGGGGGAAAGGGTGGGAGGAAGG - Intergenic
1010800036 6:80164466-80164488 GGGGAGTAGGTGATGGAGGGAGG - Intronic
1011565386 6:88667226-88667248 GGGGGGCAAGTGATAAAGGAAGG + Intronic
1011841173 6:91501008-91501030 GGGAGGAAAGTGAAGGAGGGAGG - Intergenic
1011940605 6:92837541-92837563 GGGGGCAAAGTGGGAGAGGATGG - Intergenic
1012009918 6:93770453-93770475 TGGAGGAAAGTGTTGAAGGAAGG + Intergenic
1012247282 6:96939677-96939699 GGGGGAAATGTGCTGGAGGACGG + Intronic
1012575305 6:100789090-100789112 GGGAGGAAAGGAAAGGAGGAAGG + Intronic
1013153257 6:107467356-107467378 AAGGGGAAAGGGATGGAGAAAGG - Intergenic
1013227749 6:108132825-108132847 GCGGGGAAAATGAGGGAGGGTGG - Intronic
1013245032 6:108278100-108278122 GGGGGAAGAGTAATGGAGGAAGG + Intergenic
1013442250 6:110182098-110182120 GGTGGGTAAGTGCTGGAGGCAGG - Intronic
1013560192 6:111296000-111296022 TTGGGGAAAGTGATAGAGTAAGG - Intergenic
1013651168 6:112196319-112196341 AGGTGGTAAGTGATGGGGGAAGG - Intronic
1013768887 6:113605049-113605071 GAGGGGCAAGAGAAGGAGGAAGG - Intergenic
1014177764 6:118349000-118349022 AGGGAGAGAGGGATGGAGGAAGG - Intergenic
1014191191 6:118498648-118498670 GGGAGGAAAGGGAGGGAGGGAGG + Intronic
1014884838 6:126767116-126767138 GGGGAGGAAGGGAAGGAGGAAGG - Intergenic
1015210973 6:130697956-130697978 GGGTGGCCAGTGGTGGAGGAAGG - Intergenic
1015505784 6:133986134-133986156 GGGGGTAAAGTGAGTCAGGAAGG + Intronic
1015549368 6:134396096-134396118 CGGGGGAGAGGGAGGGAGGAAGG - Intergenic
1016001622 6:139047587-139047609 GTGGGGCAAGTGATTGAGCAGGG + Intergenic
1016083631 6:139885524-139885546 GGGGGGATAGTGGTGAAGAAGGG - Intergenic
1016301808 6:142640118-142640140 GAGGGGAATGTGATTGGGGAAGG + Intergenic
1016833692 6:148456224-148456246 AGGGGGAAAGTGAGGCAGCAGGG - Intronic
1017472257 6:154750451-154750473 TGGGGGAAAGGGAGGGAGGGAGG - Intronic
1017779635 6:157705889-157705911 GGAGGGATAGTGAGGGAGGTTGG + Intronic
1017996774 6:159538403-159538425 GGGGAGAAAGAGAGGAAGGAAGG + Intergenic
1018140544 6:160829681-160829703 AGGGAGAAAGGGAAGGAGGAGGG + Intergenic
1018265083 6:162015588-162015610 GGGGAGAAAGGAAGGGAGGAGGG - Intronic
1018374069 6:163194866-163194888 GAGGGGAGAGTGAAGGAGGTGGG - Intronic
1018928795 6:168225922-168225944 GGGGAGAAGGAGAAGGAGGAGGG - Intergenic
1019313467 7:373971-373993 GGAGGGAAAGGGAAGGAGGGAGG + Intergenic
1019332274 7:466393-466415 GGGAGGAGGGTGAGGGAGGAGGG - Intergenic
1019332279 7:466406-466428 GGGAGGAGGGTGAGGGAGGAGGG - Intergenic
1019332326 7:466574-466596 GGGAGGAGGCTGATGGAGGAGGG - Intergenic
1019332335 7:466610-466632 GGGTGGAGGGTGAGGGAGGAGGG - Intergenic
1019332352 7:466662-466684 GGGAGGAGAGTGAAGGAGGAGGG - Intergenic
1019332364 7:466714-466736 GGGAGGAGAGTGAAGGAGAAAGG - Intergenic
1019332377 7:466779-466801 GGGAGGAGGGTGAAGGAGGAGGG - Intergenic
1019332405 7:466863-466885 GGGAGGAGGGTGAGGGAGGAGGG - Intergenic
1019335707 7:481593-481615 GGGCGGGAAGGGAGGGAGGAGGG - Intergenic
1019414175 7:919846-919868 GGAGGGAAAGAGATGGGGGAGGG + Intronic
1019414183 7:919867-919889 GGAGGGAAAGAGATGGGGGAGGG + Intronic
1019414191 7:919888-919910 GGAGGGAAAGAGATGGGGGAGGG + Intronic
1019531814 7:1507027-1507049 GGGTTGAAAGGGATGGGGGATGG - Intergenic
1019576381 7:1739631-1739653 GTGGGGAAGGTGAAGGAGGCTGG + Intronic
1019697284 7:2452662-2452684 GGGAGGGAAGGGAGGGAGGAAGG - Intergenic
1019785878 7:2977121-2977143 GGGGAGGCAGGGATGGAGGAGGG + Intronic
1019911056 7:4100754-4100776 GTGGGGAAGGTGGTGTAGGAGGG + Intronic
1019989327 7:4681257-4681279 GGAAGGAAAGGGAGGGAGGAAGG + Intergenic
1020011402 7:4807704-4807726 GGGGAGAAGGAGAGGGAGGAGGG - Intronic
1020116482 7:5479342-5479364 GTGGGGAATGTTCTGGAGGAAGG + Intronic
1020306974 7:6842939-6842961 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1020311459 7:6871795-6871817 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1020323021 7:6954122-6954144 GGAGGACAAGTGATGGAGGAAGG - Intergenic
1020462071 7:8437247-8437269 GGGGTGAAAATGATTGAAGATGG - Intronic
1021509998 7:21425275-21425297 GAGGGGAAAGGGAGGGAGGAAGG - Intergenic
1021986374 7:26101817-26101839 GGGCAGAAAGTGAGGGAGGATGG + Intergenic
1022629498 7:32071478-32071500 GGGGTGAAAGGGAGGGAGGGAGG - Intronic
1022816533 7:33919520-33919542 GGTGGGACAGTGGTGGAGGGAGG + Intronic
1023022511 7:36022831-36022853 GTGGGGAGAGAGATGGAGGTGGG + Intergenic
1023281750 7:38577769-38577791 GGAGAGAAAGAGAAGGAGGAAGG + Intronic
1023370185 7:39505496-39505518 GGGGGGAAAGAGAGGGAGGGAGG - Intergenic
1024082396 7:45865996-45866018 TGGGGGAAAGGGATGGGGCAGGG + Intergenic
1024204501 7:47145396-47145418 GGAGGGAAAATGATAGAGAATGG - Intergenic
1024283209 7:47736317-47736339 GGAGGGAAAGGGAGGGAGGGAGG - Intronic
1024347321 7:48326218-48326240 GGAGGGACAGTGAAGGAAGAGGG - Intronic
1024522905 7:50322727-50322749 GGTGGGAAAGTGAAGGATGTGGG + Intronic
1024875718 7:54020714-54020736 CGGGGGAAAGAGTGGGAGGAGGG - Intergenic
1025602540 7:63013794-63013816 GGAGGGAAGGGGATGAAGGAAGG + Intergenic
1026405047 7:70056389-70056411 AGGGTGAAGGTGATGAAGGAGGG - Intronic
1026606909 7:71824287-71824309 GGGGGGACAATGATTGAGGAAGG - Intronic
1026638797 7:72106647-72106669 GGGGGAAAAGGGAAGGAGGGAGG + Intronic
1026830423 7:73607058-73607080 GGGGGGAAAGTGATGGAGGATGG - Intronic
1026833048 7:73621867-73621889 GGAGGGAGGGAGATGGAGGAGGG - Intronic
1026837569 7:73648596-73648618 GGGGGGAGAGTGAAAAAGGAGGG - Intergenic
1026890892 7:73981559-73981581 GGGAGGAAAGGGAGGGAGGAAGG + Intergenic
1027390413 7:77697373-77697395 GGAGGGAACGGGATGGGGGAAGG + Intronic
1027655891 7:80930430-80930452 GGGGGGAGGGTGGTGGGGGATGG - Intergenic
1028068852 7:86423778-86423800 GGTGGGAAGGGGTTGGAGGAGGG + Intergenic
1028071981 7:86461502-86461524 GGGGGGGCAGTGGAGGAGGAAGG - Intergenic
1028097646 7:86782173-86782195 AGGGTGAAAGGGAAGGAGGAAGG - Intronic
1028134277 7:87210001-87210023 GGGGGGACAGAGAGAGAGGAGGG + Intronic
1028231718 7:88313600-88313622 GGGGAGCAAGTGAAGGAGGTGGG - Intergenic
1028540374 7:91936986-91937008 GCGAAGAAAGTGAAGGAGGAGGG - Intergenic
1028960692 7:96746673-96746695 GGGAGTAAAGTGATGGAGTGGGG - Intergenic
1028966467 7:96807204-96807226 GAGGAGAAAGTGAAGGGGGAAGG + Intergenic
1028986265 7:97011089-97011111 GGAAGGGAAGTGAGGGAGGAGGG - Intergenic
1029078133 7:97951887-97951909 GAGGGACAAGTGATGGAAGAAGG - Intergenic
1029144954 7:98439267-98439289 GGGGAGGAAGAGAGGGAGGAAGG - Intergenic
1029392179 7:100282588-100282610 GGGGGGGAAGGGAAGGGGGAGGG - Intergenic
1029412834 7:100426826-100426848 GGGAGGAAAGGGAAGGAGGAGGG - Intronic
1029630010 7:101744198-101744220 GGGCTGAAGGTGATGGGGGAGGG - Intergenic
1029655628 7:101922643-101922665 GGGTGGAAGGGGATGAAGGAGGG + Intronic
1031847304 7:126821608-126821630 GGAAGGAGAGTGATGGGGGATGG - Intronic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1032465524 7:132142057-132142079 TGGAGGAAGGTGGTGGAGGATGG + Intronic
1032644908 7:133812891-133812913 GGGGGCTAAGGGATGGGGGAGGG - Intronic
1033133342 7:138764223-138764245 AGGGGAAAGGAGATGGAGGAGGG + Intronic
1033184184 7:139210862-139210884 TGGTGGAAGGTGAAGGAGGAAGG + Intergenic
1033420178 7:141198650-141198672 TGGGAGACAGTGATGGAGGCAGG - Intronic
1033454330 7:141488947-141488969 GAGGAGAAAGAGAAGGAGGAGGG + Intergenic
1033786478 7:144737270-144737292 GGGGGAGAAGGGAGGGAGGAAGG + Intronic
1034358450 7:150472846-150472868 GGGGGGAGTGTGAGGGAGGGAGG + Intronic
1034367242 7:150561594-150561616 GGGGGGCAAGTGCTGGTGGAAGG - Intergenic
1034818676 7:154196918-154196940 GGGTGCAAAGTCATGGAGGTAGG - Intronic
1035407222 7:158607051-158607073 GAAGGTAAGGTGATGGAGGATGG + Intergenic
1035733679 8:1872049-1872071 GAGGGGAGAGGGATGGAAGAAGG + Intronic
1035911145 8:3567513-3567535 AGGGGGAAGGGGATGGGGGAGGG + Intronic
1036111478 8:5907586-5907608 AGGGAGAAAGTGAAGGAGGAAGG + Intergenic
1036239877 8:7072620-7072642 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036262004 8:7248547-7248569 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036304587 8:7591011-7591033 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036314043 8:7707086-7707108 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036355438 8:8039003-8039025 GAAGGACAAGTGATGGAGGAAGG + Intergenic
1036371868 8:8169250-8169272 GGAGGGATAGTGAGGGAGGTTGG - Intergenic
1036373039 8:8176860-8176882 AGAGGACAAGTGATGGAGGAAGG + Intergenic
1036465289 8:8991764-8991786 GGGGGGAAAATCCTGGAGGAAGG + Intergenic
1036820136 8:11933614-11933636 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036833304 8:12038539-12038561 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036855150 8:12285104-12285126 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036877866 8:12488781-12488803 AGAGGACAAGTGATGGAGGAAGG - Intergenic
1036879034 8:12496394-12496416 GGAGGGATAGTGAGGGAGGTTGG + Intergenic
1036903465 8:12688957-12688979 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1036905954 8:12708624-12708646 GAAGGACAAGTGATGGAGGAAGG - Intergenic
1037111478 8:15168582-15168604 CGGGGGTAAGTGATGGAGACAGG - Intronic
1037216342 8:16456718-16456740 GGGAGGAAAGGAAGGGAGGAAGG + Intronic
1037656173 8:20886042-20886064 GGAGGGAAGGAGAGGGAGGAGGG + Intergenic
1037689435 8:21170186-21170208 GAGGGAAAAGGGAAGGAGGATGG - Intergenic
1037965669 8:23131938-23131960 GGAGGGAAGGTGAAAGAGGAAGG + Intergenic
1038386937 8:27157074-27157096 GCAGGGCAAGTCATGGAGGATGG + Intergenic
1038448429 8:27620809-27620831 GGGAAGAAAGGAATGGAGGAAGG - Intergenic
1038483747 8:27919182-27919204 GAGGGGAAAGAGGAGGAGGAGGG + Intronic
1038550097 8:28460104-28460126 TGGGGGATAGTGATGGGAGAGGG - Intronic
1038736575 8:30175007-30175029 GGGTGGAAGGTGACTGAGGATGG - Intronic
1039226373 8:35392736-35392758 GGGGGTAAAGGGGTGGAAGATGG + Intronic
1039230843 8:35446153-35446175 GGGGGGAAAGTGTGGGAAGGGGG - Intronic
1039408329 8:37331374-37331396 CGGGGGAGACTGAAGGAGGAGGG + Intergenic
1040529900 8:48258095-48258117 TGGGGGAAAGTGAGGCAGGTGGG + Intergenic
1041330050 8:56714453-56714475 GGAAGGACAGTGAGGGAGGAAGG - Intergenic
1041342758 8:56863419-56863441 GGGGAAAAAGAGAAGGAGGAGGG + Intergenic
1041444236 8:57932079-57932101 GGGGGGGCAGGGAGGGAGGAAGG + Intergenic
1041570797 8:59335040-59335062 TGGGGGAAAGTAATGCAGGAAGG - Intergenic
1041719353 8:60962152-60962174 GGGGGGAGAGAGAGGGAGGGAGG - Intergenic
1041896230 8:62927318-62927340 GGGGAGAAAGTGTTCAAGGAAGG - Intronic
1042282176 8:67066195-67066217 TGGGGGAAAGAGAGGGAGGCTGG - Intronic
1042404513 8:68388530-68388552 GGGGGAAAAGTGGAGGAGAAGGG - Intronic
1042869021 8:73380649-73380671 GGGGGGTTTGTGATGCAGGAAGG - Intergenic
1043356881 8:79424044-79424066 GGAAGGAAAGGGAGGGAGGAAGG + Intergenic
1043975632 8:86581719-86581741 GGGGGGTAAGGTATGGAGAAGGG - Intronic
1043986594 8:86699911-86699933 GGGAGGAAAGGAAGGGAGGATGG - Intronic
1044506709 8:93028847-93028869 GGGGATAGAGTGATGGAGCAGGG - Intergenic
1044591579 8:93917711-93917733 GGGGGGAAGAGGATGGAGGAGGG - Intronic
1044746506 8:95376108-95376130 TGGGGGAAATTGCTGGTGGAAGG + Intergenic
1045100581 8:98839965-98839987 GGGGAGAAAGTAATAGAGAAGGG + Intronic
1045155288 8:99462149-99462171 AGGGAGAAAGGGAGGGAGGAAGG - Intronic
1045330922 8:101155081-101155103 GGGGGAGAAGGGAGGGAGGATGG - Intergenic
1045411977 8:101929246-101929268 GAGGAGGAAGGGATGGAGGAAGG + Intronic
1045523207 8:102921408-102921430 GGGAGGGAAGGGAGGGAGGAAGG - Intronic
1045748999 8:105459448-105459470 GGGGGGAAAGTAGTGGAGTTTGG - Intronic
1045757077 8:105556670-105556692 GGGGGAAAAGGGAAGGGGGAAGG - Intronic
1046490423 8:114945316-114945338 TGGGGGAAAGTGTGGGAGGCGGG - Intergenic
1046555571 8:115768748-115768770 GGGAGGAAAGGAAGGGAGGAAGG - Intronic
1046870825 8:119204382-119204404 GGGAAGAAGGGGATGGAGGAGGG + Intronic
1047254817 8:123207085-123207107 GGAGGGGAAGTGGAGGAGGAGGG - Intronic
1047330902 8:123885872-123885894 GGGAGGAAGGTGATGAAAGATGG - Intronic
1047715070 8:127587835-127587857 GGTTGGAATGTGATAGAGGAAGG - Intergenic
1047777393 8:128084239-128084261 AGGGGGAAAGTGGCAGAGGAAGG - Intergenic
1047785321 8:128148659-128148681 GGTGGGAAAGAGAAGGAGGGAGG + Intergenic
1047858899 8:128942692-128942714 GGGGGCAAAGTAATTGAGAAGGG - Intergenic
1048690342 8:136955820-136955842 AGGGAGGAAGTGAGGGAGGAAGG - Intergenic
1048690358 8:136955876-136955898 GGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1048997034 8:139800812-139800834 GGAGGGAAGGTGCTGGAGGGAGG - Intronic
1049214818 8:141402706-141402728 GGGGGGAAAGTGAGGAAAAAGGG - Intronic
1049231749 8:141488343-141488365 GGAGGGAATGTCAGGGAGGAAGG - Intergenic
1049889420 9:54814-54836 GAGGGGAGGGTGATGGAGAATGG - Intergenic
1050290169 9:4145749-4145771 AGGGAGAAAGTGAGGGAGGGAGG - Intronic
1050305342 9:4300018-4300040 GGGGGAAGAGGGAGGGAGGAAGG + Intronic
1050357757 9:4799051-4799073 AGGGGGAGAGGGATGGGGGAGGG - Intronic
1050801017 9:9614989-9615011 GGGGAGAAATTGCAGGAGGAAGG + Intronic
1051261958 9:15273456-15273478 GGGAGGAATGTGGAGGAGGAGGG - Intronic
1051307628 9:15731204-15731226 GGGAGGAAAGGGATGGAGAGAGG - Intronic
1051503163 9:17800299-17800321 GATGGGGAAGTGATGAAGGAGGG + Intergenic
1051528903 9:18078002-18078024 GGGTGGGAAGGGATGGAGGAAGG + Intergenic
1052475671 9:28956567-28956589 GGGGAGGGAGGGATGGAGGAAGG - Intergenic
1052926961 9:34025274-34025296 GAGTGGAAAGTGATAGATGATGG - Intronic
1053317462 9:37064116-37064138 GAGGGAAAAGGGAGGGAGGAAGG - Intergenic
1053415131 9:37942697-37942719 GCGGGGAAAGAGATGGAAGCAGG + Intronic
1053946374 9:43312960-43312982 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1054901158 9:70370779-70370801 GAGGGGAAAGGGGAGGAGGAGGG + Intergenic
1055106983 9:72523225-72523247 GTGGGGAAAATGAAGGAGAAGGG + Intronic
1055581479 9:77711145-77711167 GAGGGGAAGGGGAAGGAGGAGGG - Intergenic
1055831776 9:80388080-80388102 GGGGGGAAGATGCTGGGGGAAGG - Intergenic
1056344144 9:85673232-85673254 AGGGGGATAGGGAAGGAGGATGG + Intronic
1056545155 9:87606813-87606835 GGGGAGAAAGGGAGGAAGGAAGG - Intronic
1056719226 9:89058823-89058845 TGGAGGACAGTGGTGGAGGATGG + Intronic
1056719310 9:89059186-89059208 TGGAGGACAGTGGTGGAGGACGG + Intronic
1056719414 9:89059633-89059655 GTGGAGGACGTGATGGAGGATGG + Intronic
1056767867 9:89455730-89455752 GTCTGGAAAGTGAGGGAGGAAGG - Intronic
1056965519 9:91160747-91160769 GGGGGGAAGGGGAGGAAGGATGG - Intergenic
1057226426 9:93295727-93295749 GGGAGGAAGGTGGGGGAGGAAGG - Intronic
1057226742 9:93296706-93296728 GGGAGGATAGAGAGGGAGGAAGG - Intronic
1057294382 9:93826903-93826925 GGAGGGAAAAGGATGGGGGAGGG - Intergenic
1057387314 9:94615390-94615412 GGGGGGACTGAGATGGAGAATGG + Intronic
1057523417 9:95778671-95778693 AGGAGGAAAGGGAGGGAGGAAGG - Intergenic
1057784389 9:98075449-98075471 GGGAGGAAAGGGAGGGAGGGAGG + Intronic
1058067383 9:100564611-100564633 TGGGGGACATTGTTGGAGGAAGG + Intronic
1058119208 9:101119831-101119853 GGGAGGGAAGTGAAGAAGGATGG - Intronic
1058156139 9:101518025-101518047 GAGGAGAAAGGGAGGGAGGAAGG - Intronic
1058377095 9:104335466-104335488 GGGGAGAAGGGGATGGAGAAAGG - Intergenic
1058665767 9:107313945-107313967 GGGAAGAAAGGGAAGGAGGAAGG - Intronic
1058893959 9:109383935-109383957 GTGGGGAGAATGGTGGAGGAGGG - Intronic
1058954662 9:109934519-109934541 GGAGGGACAGGGATGGCGGAGGG - Intronic
1059147679 9:111916325-111916347 ATGGGGAAAGTGAAAGAGGATGG - Intronic
1059221111 9:112619556-112619578 GGGGGGAAAGGGTAGAAGGAGGG + Intronic
1059675823 9:116538185-116538207 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1059814665 9:117899331-117899353 GGGGGAGAAGAGATGGAGCAAGG - Intergenic
1059903471 9:118954766-118954788 TGGGGGGAAGTGATGGAGGATGG + Intergenic
1059917487 9:119119609-119119631 AGAGGGAAAGAGATGGGGGAAGG - Intergenic
1059976697 9:119725273-119725295 TGGGGGAAGGTGGTGGAGGGAGG - Intergenic
1060029647 9:120203334-120203356 GGGGAGAGAGTGGTGGAGGAAGG + Intergenic
1060193911 9:121610646-121610668 GGTGGGAAGGTGATGGATGAAGG + Intronic
1060394413 9:123305430-123305452 GGGGGTGAAGTGCTGGATGAGGG + Intergenic
1060485323 9:124042700-124042722 GGGGGGGCAGTGATGCAGGCTGG + Intergenic
1060720915 9:125976787-125976809 GGAGGGAAGGAGAGGGAGGAAGG - Intergenic
1060724725 9:125999339-125999361 GGGAGGAAGGTGAGGGGGGAAGG + Intergenic
1061009727 9:127947957-127947979 GAGGGGAGAGTGATGGTGGGAGG - Intronic
1061360445 9:130138514-130138536 GAGGAGAAAGAGGTGGAGGAGGG - Exonic
1061789004 9:133048780-133048802 TGGGGTAAAATGAGGGAGGAGGG + Intronic
1062224041 9:135438932-135438954 GGAGGACAAGTGATGGAGGAAGG - Intergenic
1062638364 9:137503439-137503461 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638371 9:137503458-137503480 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638378 9:137503477-137503499 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1062638397 9:137503534-137503556 AGGGGGAAGGAGAAGGAGGAGGG + Intronic
1203589504 Un_KI270747v1:41518-41540 GAAGGGAAAGGGAGGGAGGAAGG + Intergenic
1185485846 X:481525-481547 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485914 X:481752-481774 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485936 X:481820-481842 GGGAGGAAGGAGACGGAGGAAGG + Intergenic
1185485956 X:481894-481916 GGGAGGAAGGAGAGGGAGGAAGG + Intergenic
1185485984 X:481992-482014 GGAAGGAAGGAGATGGAGGAAGG + Intergenic
1185581350 X:1213202-1213224 GGGAGGAAAGGGAAGGGGGAGGG - Intergenic
1185586311 X:1244354-1244376 GGAGGGAAAGAGAGGAAGGAAGG + Intergenic
1185608540 X:1380662-1380684 AGGGGGGAAGGGGTGGAGGAGGG + Intronic
1185708494 X:2282759-2282781 GGGGAGAAAGCGAGGGAGGGAGG + Intronic
1185708519 X:2282872-2282894 GGGGAGAGAGGGAGGGAGGAGGG + Intronic
1185954839 X:4478187-4478209 GAGGGGAAAATGAGGAAGGAAGG + Intergenic
1186370951 X:8946875-8946897 GGGGGAAACTTGATGGAGGGTGG - Intergenic
1186523628 X:10228210-10228232 GGGGAGGAGGGGATGGAGGATGG - Intronic
1187126800 X:16461923-16461945 GGGGAGGGAGGGATGGAGGAAGG + Intergenic
1188308403 X:28586729-28586751 GGGGAGACAGTGATGGGGGTGGG + Intergenic
1189319799 X:40080869-40080891 GGGAGGGAAGGGGTGGAGGATGG + Intronic
1189375818 X:40465634-40465656 GGGGGGAGAGTGAGGAAGAAAGG + Intergenic
1189650936 X:43188722-43188744 GGAGGGAAAGGGATGCAGGTGGG - Intergenic
1189823146 X:44890067-44890089 GGGTGGGAAGAGATGAAGGAAGG - Intronic
1189824887 X:44908017-44908039 GGGGAAAAAGTAATAGAGGAGGG + Intronic
1189874814 X:45424806-45424828 GGGGGGAAAGGGAGGGAGGTAGG + Intergenic
1189962925 X:46341564-46341586 GCGGGGGAAGTGATGGGGCAGGG + Intergenic
1190739564 X:53280260-53280282 AGGGAGGAAGGGATGGAGGAAGG + Intronic
1192430754 X:71109998-71110020 GGGGGAAAGGAGTTGGAGGAGGG + Intronic
1192539433 X:71955709-71955731 GGAGGGAAAATGACAGAGGATGG + Intergenic
1192773084 X:74214099-74214121 GTGGGGAAAGAAATGGAGGAAGG + Intergenic
1192837766 X:74820186-74820208 GGGGGGTGAGGGTTGGAGGAGGG + Intronic
1193018822 X:76767717-76767739 GGGGAAAAAGTGATGGGGGAGGG - Intergenic
1193441837 X:81550758-81550780 GGTGGGGAAGTGTGGGAGGAGGG + Intergenic
1194352127 X:92834067-92834089 TGGGGGAGGGTGCTGGAGGAGGG + Intergenic
1194400598 X:93434751-93434773 GGAGGACAAGTGATGGAGGAAGG + Intergenic
1194897723 X:99466579-99466601 GAGGGGAATGTGAGGAAGGAGGG + Intergenic
1195861477 X:109388038-109388060 GGGGTGAAAAGGATGGGGGAAGG + Intronic
1195876776 X:109550423-109550445 TGGGGGAAGGTGAGGGAGAATGG + Intergenic
1196004032 X:110816597-110816619 GAGGGGAGAGTGATGGGGGAAGG + Intergenic
1196480834 X:116145742-116145764 GGTGGTAAGGTGTTGGAGGAGGG + Intergenic
1196650078 X:118159356-118159378 GGGGGGGGAGGGAAGGAGGAAGG + Intergenic
1196798928 X:119524821-119524843 GGGGCCAGAGTGAGGGAGGAGGG - Intergenic
1196834486 X:119801906-119801928 GGAGGGAAAGAGAAGGAGGGAGG - Intergenic
1196913236 X:120505556-120505578 GGAGGGAAAGGGAAGGAGGGAGG - Intergenic
1197188742 X:123620915-123620937 TGGAGGAATGTGATGGAGAAGGG + Exonic
1197286159 X:124597526-124597548 GGTGGGAGAGGGATAGAGGATGG + Intronic
1197693158 X:129523567-129523589 GGGGGGAGAGTGACGGGGGGAGG - Intergenic
1197834185 X:130677203-130677225 GAGGAGGAAGTGAGGGAGGAAGG - Intronic
1197837921 X:130714851-130714873 GGAGAGAAGGTGGTGGAGGAGGG + Intronic
1198044244 X:132884292-132884314 GGAGGGAGAGAGATGAAGGATGG + Intronic
1198116495 X:133549764-133549786 GGAGGGAGAGAGAGGGAGGAAGG - Intronic
1198135727 X:133748551-133748573 GGGGGAAGAGAGATGGAGGGAGG - Intronic
1198517826 X:137427060-137427082 GGGAGGAAGGGGATGGGGGAGGG + Intergenic
1198716973 X:139567803-139567825 GGGAGGTAAGGGAGGGAGGAAGG + Intergenic
1198796655 X:140403882-140403904 TGGGGGAAAGGGTCGGAGGAGGG - Intergenic
1199308826 X:146298491-146298513 GGAGGGAAAATAAGGGAGGAAGG - Intergenic
1199509255 X:148602040-148602062 TGGGGTAAAGTGATGGAGTGAGG + Intronic
1200158902 X:153994362-153994384 GGGTGGCAAGTGCTGGAGGAGGG + Intergenic
1200305996 X:155026720-155026742 GGGGGGAAAGTGGGGGAGAGTGG + Exonic
1201300247 Y:12498763-12498785 GGGGGGGAAGGGGGGGAGGAGGG - Intergenic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201341127 Y:12935573-12935595 GGGAGGGAAGGGAAGGAGGAAGG - Intergenic
1201354643 Y:13084146-13084168 GGGGTTAAAGTGATGGTGGCTGG - Intergenic
1201451165 Y:14116246-14116268 AGGGGGGAAGGGATGGAGGGAGG + Intergenic
1201698498 Y:16854170-16854192 GGGGAGGAAGGGAGGGAGGAAGG - Intergenic
1201722510 Y:17116093-17116115 GGGGAGCAAGGAATGGAGGAGGG - Intergenic
1202037350 Y:20648272-20648294 GGAGGGCAAGTGATAGAAGAGGG + Intergenic