ID: 1026831528

View in Genome Browser
Species Human (GRCh38)
Location 7:73613156-73613178
Sequence TGGGCTTCACGGGAGTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 2, 3: 29, 4: 243}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026831528_1026831534 -8 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831534 7:73613171-73613193 GAAGCCCACCTTCAAACCTTTGG 0: 1
1: 0
2: 1
3: 5
4: 116
1026831528_1026831544 11 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831544 7:73613190-73613212 TTGGCGTTTAGGGAGGAGGAGGG 0: 1
1: 1
2: 2
3: 22
4: 297
1026831528_1026831538 0 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831538 7:73613179-73613201 CCTTCAAACCTTTGGCGTTTAGG 0: 1
1: 0
2: 0
3: 6
4: 74
1026831528_1026831539 1 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831539 7:73613180-73613202 CTTCAAACCTTTGGCGTTTAGGG 0: 1
1: 0
2: 0
3: 9
4: 127
1026831528_1026831541 7 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831541 7:73613186-73613208 ACCTTTGGCGTTTAGGGAGGAGG No data
1026831528_1026831540 4 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831540 7:73613183-73613205 CAAACCTTTGGCGTTTAGGGAGG No data
1026831528_1026831545 12 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831545 7:73613191-73613213 TGGCGTTTAGGGAGGAGGAGGGG 0: 1
1: 0
2: 3
3: 38
4: 385
1026831528_1026831543 10 Left 1026831528 7:73613156-73613178 CCTCCCCACTCCCGTGAAGCCCA 0: 1
1: 0
2: 2
3: 29
4: 243
Right 1026831543 7:73613189-73613211 TTTGGCGTTTAGGGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026831528 Original CRISPR TGGGCTTCACGGGAGTGGGG AGG (reversed) Intronic
900618021 1:3574030-3574052 TGGGCCTCTCGGGTGTGGGCTGG - Intronic
900995711 1:6122212-6122234 TGGGCCTCACAGGCCTGGGGCGG - Intronic
901238112 1:7678398-7678420 TGGGCTTCAAGGGAGCAGGCAGG + Intronic
902501398 1:16914016-16914038 TGCGCTGCGCGGTAGTGGGGCGG - Intronic
902522645 1:17029408-17029430 TAGGCTTGACGGGTGTGTGGTGG - Intronic
903533099 1:24047255-24047277 TGGGCTTCTCTGGAGTGCTGAGG + Intergenic
903543064 1:24107709-24107731 TGGGCTTCACGTGGTGGGGGAGG - Intronic
905093662 1:35450315-35450337 AGAGCTACACAGGAGTGGGGAGG - Intronic
905819719 1:40979988-40980010 TGTGCCTAACGGGAGTGGGGCGG + Intronic
906292945 1:44631818-44631840 TAGGCTTCACGGGCGGTGGGAGG + Intronic
907193211 1:52665738-52665760 TGGGGTACAGGGAAGTGGGGGGG - Intronic
907304878 1:53507849-53507871 TGGGCTGGATGGGGGTGGGGAGG + Intronic
907445700 1:54506437-54506459 TGGGGTACACAGGAGAGGGGTGG + Intergenic
908165298 1:61451553-61451575 TGTGCTGAGCGGGAGTGGGGAGG - Intronic
908774333 1:67625799-67625821 TGGGCTTGAGGGGAGGGGAGGGG - Intergenic
909756081 1:79227577-79227599 TTGGCTTGATGGGAGTTGGGAGG - Intergenic
910930932 1:92441984-92442006 GGGGGCTCACGGGAGAGGGGCGG + Intergenic
913484249 1:119319388-119319410 CGTGATTCACTGGAGTGGGGTGG - Intergenic
915042492 1:152980828-152980850 TGGGCTTTAGGGAAGTGTGGGGG + Intergenic
915648027 1:157287831-157287853 TGGGGTTCGTGGCAGTGGGGAGG - Intergenic
915662640 1:157416669-157416691 TGGGGTTCATGGCAGTGGGGAGG + Intergenic
915895669 1:159809166-159809188 TGGGCTTTACTGGTGTGAGGTGG + Exonic
915920615 1:159973054-159973076 TGGGCTTTACTGGTGTGAGGCGG - Intergenic
919762092 1:201104354-201104376 TGGTTTTCAAGGGATTGGGGAGG - Intronic
920689157 1:208132402-208132424 TTGGCTTCAGAGGTGTGGGGTGG + Intronic
921746779 1:218749555-218749577 TGGGTTTCACGGGGCTGTGGTGG + Intergenic
922822619 1:228494492-228494514 TGGGAGGCACAGGAGTGGGGTGG - Exonic
924287533 1:242503526-242503548 TGTGCTTCAAGGAAGTGGAGGGG - Intronic
924797446 1:247302212-247302234 TGGGCTTCATGACTGTGGGGAGG + Intronic
1066064127 10:31750112-31750134 TGGGCTTCAGGGGAGAGGGGAGG + Intergenic
1066462595 10:35624759-35624781 TGGACTTCACGGGGTTGGAGGGG + Intergenic
1067382411 10:45787169-45787191 TGTCCTTCCCGGGAGTGGGGAGG + Exonic
1067890111 10:50127717-50127739 TGTCCTTCCCGGGAGTGGGGAGG + Exonic
1068652592 10:59539101-59539123 TGGGTTTCAGGGGTCTGGGGAGG - Intergenic
1070692053 10:78534181-78534203 TCAGCTTCATGGGAGAGGGGAGG - Intergenic
1070744336 10:78923825-78923847 TGGGATTGATGGGAGTGGGGGGG - Intergenic
1072009448 10:91290769-91290791 TGGGCGTCACTGGAGGGGTGAGG - Intergenic
1076412680 10:130263361-130263383 TGGGCTACACCGAAGTGGGAAGG - Intergenic
1076618312 10:131771156-131771178 TGGGCTTCCCGGCAGCGGGAGGG - Intergenic
1076768324 10:132649762-132649784 TGGGCTCCAGGGGTGTGCGGTGG + Intronic
1077350865 11:2092628-2092650 TGGGCTCCAGGGGAGGTGGGAGG + Intergenic
1077370705 11:2180407-2180429 TGAGCTTGGCCGGAGTGGGGCGG - Intergenic
1078005731 11:7531017-7531039 TGGACTCCAGGGGAGTGGGAAGG - Intronic
1082984419 11:59155772-59155794 TGGGGTTCAGGGGAGAGGGGAGG - Intergenic
1083826995 11:65209651-65209673 TGGGCTGCAGTGGAGTGGGCTGG - Intronic
1084418511 11:69048805-69048827 TGGGGTTCTCCTGAGTGGGGCGG - Intergenic
1086953026 11:92909915-92909937 TGGGCTTCTGGGAAGTGGGCTGG + Intergenic
1089688659 11:120172594-120172616 TGGGGTTCAGCGGAGTGGCGTGG + Intronic
1090433198 11:126663915-126663937 AGGGCTTTACAGGACTGGGGTGG - Intronic
1091680075 12:2520872-2520894 TGTGCTTCAGAGGAGTGGGAAGG + Intronic
1092861662 12:12724527-12724549 TGGGCTTCACAGGCGAGGAGCGG + Intergenic
1096978188 12:55712344-55712366 TGGGCTTCAAGAGAGGGGGTTGG - Intronic
1101474065 12:105027343-105027365 TGGGAGTCATGGGAGAGGGGAGG - Intronic
1103836934 12:123829152-123829174 TAGGCATTAGGGGAGTGGGGTGG + Intronic
1104678071 12:130729281-130729303 TGGGTGTGACGGGGGTGGGGAGG + Intergenic
1104866724 12:131960377-131960399 TGGGCCACACGGGAGTGGGTGGG - Intronic
1105801243 13:23904290-23904312 TGGGCTGCACTGGGGAGGGGCGG - Intergenic
1106592031 13:31106100-31106122 GGGGCTCCACGGGCGTGGGGTGG - Intergenic
1109396489 13:61766134-61766156 TGGGCTTCGAGGGGGCGGGGCGG + Intergenic
1112485612 13:99816895-99816917 GGGGCTTCATGGAAGTGGTGGGG + Intronic
1112631097 13:101162053-101162075 TGGACTTCACGGAGGTGTGGTGG - Intronic
1112793622 13:103030177-103030199 TGGGTTTTACTGGAGTGGGCTGG + Intergenic
1112859748 13:103815672-103815694 TGGGCCTCACGGTGGTGGGGTGG - Intergenic
1112893136 13:104263608-104263630 ACGGCTGCACGGGAGTGGGGAGG + Intergenic
1113697586 13:112357107-112357129 TGTGCTTAGAGGGAGTGGGGAGG - Intergenic
1116000826 14:39241206-39241228 TGGGCTTCAAGGGAATCAGGAGG + Intronic
1116507818 14:45706758-45706780 TTGGCTTCACTGGACTGTGGTGG + Intergenic
1117024608 14:51607074-51607096 TGGGCCTCAGGGGAGTAGTGGGG - Intronic
1119895440 14:78215756-78215778 TGTGCTGCAGGGGGGTGGGGGGG + Intergenic
1121996638 14:98608101-98608123 AGGGCTGGACGGGAGTGGGATGG - Intergenic
1122267614 14:100554053-100554075 TGGGCTTCAGGGGAGCAGGAAGG - Intronic
1122320420 14:100852078-100852100 TGGGAGGCAGGGGAGTGGGGTGG + Intergenic
1122889501 14:104725808-104725830 TGGGCCTCACGGGAGCAGAGAGG - Intronic
1124966108 15:34434590-34434612 TGGGCAGCAGGGGGGTGGGGAGG + Intronic
1125518123 15:40334210-40334232 TGGGCCTCAGGGGAGGGGCGGGG + Exonic
1125736725 15:41932285-41932307 AGGGCTCCACGTGAGTGGGCGGG + Intronic
1128227054 15:66009328-66009350 TGGGAGTCATGGGGGTGGGGAGG + Intronic
1129451186 15:75652193-75652215 AGGCCTTCAAGGGAGTGGGTGGG + Intronic
1129626361 15:77204553-77204575 TGGGCATCTTGGCAGTGGGGAGG - Intronic
1129656379 15:77527896-77527918 TGGGCTTCTCTGGGGTAGGGTGG + Intergenic
1130884844 15:88084250-88084272 TGGGGTGCAGGGGAGTGAGGGGG - Intronic
1132075840 15:98819002-98819024 TGAGCTGCAAAGGAGTGGGGAGG + Intronic
1132333336 15:101027447-101027469 TGGGCTTCACAGGAGAGAGGGGG - Intronic
1132479332 16:159310-159332 GGGGCTTCAGGGGAGTGGCCAGG + Intronic
1132497164 16:269310-269332 TGGGCTCCACAGGGGTGGGAAGG + Exonic
1132523430 16:401845-401867 GGGGCGTCCGGGGAGTGGGGCGG + Exonic
1133393195 16:5425809-5425831 TGGGCTTGGCGAGAGTTGGGCGG + Intergenic
1138958135 16:61996193-61996215 TGTGCTTCAGGGGATTGGGTTGG - Intronic
1141603969 16:85142618-85142640 TGGCCGTCACAGGAGTGGGTGGG - Intergenic
1141693896 16:85611269-85611291 TGGGAGTCACGGGCGGGGGGAGG - Intergenic
1143484686 17:7247179-7247201 TGGGCTGAACCAGAGTGGGGAGG + Exonic
1145157595 17:20553442-20553464 TGGGCTTCCCTGGACTAGGGTGG + Intergenic
1146279481 17:31536021-31536043 TGGTGTTCAGGGGAGTTGGGGGG + Exonic
1146649673 17:34598834-34598856 TGGGTTTCCCTGGGGTGGGGAGG + Intronic
1147153322 17:38531025-38531047 TGGGCTTCACCCGAGCGGGTGGG + Exonic
1147926964 17:43952375-43952397 TCGGCTTCACGGGGTGGGGGAGG + Intergenic
1147948301 17:44092798-44092820 TGGGCTCCCCTGGGGTGGGGGGG + Exonic
1150331086 17:64294897-64294919 CAGGCTTCACGGGAATGGGCGGG + Intergenic
1150380058 17:64713259-64713281 TGGGCCTCCCGGGAAAGGGGAGG + Intergenic
1150387529 17:64773638-64773660 TGGCCTGCAGGGGAGTTGGGGGG + Intergenic
1151461462 17:74256594-74256616 TGGGGTCCCCGGGAGTGGGCTGG + Intronic
1151553405 17:74834752-74834774 TGGGCTTCACCTGAGGGGTGAGG + Intronic
1152162041 17:78674925-78674947 TGGGGTGCACTGGAGTGAGGGGG - Exonic
1152205978 17:78974589-78974611 TGTGCTTCATGTGCGTGGGGGGG + Intronic
1152744914 17:82034103-82034125 TGGGCTTCCCTGGAGGGGGAGGG + Exonic
1152903065 17:82956457-82956479 TGGCCTGCATGGGTGTGGGGGGG - Intronic
1154929249 18:20975201-20975223 TGGGCACCACGGTAGTGGGGTGG + Intronic
1155343795 18:24838805-24838827 TCTGGTTCACTGGAGTGGGGGGG - Intergenic
1158397991 18:57094768-57094790 CGGGCCGCACAGGAGTGGGGAGG - Intergenic
1159468842 18:68822985-68823007 TGTGCTACAGGGGAGTGTGGGGG - Intronic
1159795736 18:72841085-72841107 TGGTCTTCAGGGGAATGGAGAGG + Intronic
1161236258 19:3199625-3199647 TGGGTTGAGCGGGAGTGGGGTGG + Intronic
1162432146 19:10635517-10635539 TGGGCGTCCCCGGGGTGGGGAGG + Intronic
1162516160 19:11149122-11149144 TGGGCTTCAGGAGGCTGGGGAGG - Exonic
1162525012 19:11201852-11201874 TGGGCCTGGCGGGGGTGGGGAGG - Intronic
1162780086 19:13002390-13002412 GGGGCTCCTCGGGAGGGGGGAGG - Intronic
1162789730 19:13056572-13056594 TCGGCCTCCCTGGAGTGGGGTGG + Intronic
1162822051 19:13229049-13229071 TGGGCTACAGGGGTGGGGGGGGG + Intronic
1163476141 19:17527169-17527191 CGGGCCCCAGGGGAGTGGGGAGG + Intronic
1164976299 19:32575153-32575175 TGGGCTTCACTGGATTGGCCAGG - Intergenic
1165633815 19:37323634-37323656 TGGGCTGCACGAGAGTGGTCAGG + Intronic
1165721310 19:38081769-38081791 TGGGCATTGCGGGAGTGGTGGGG - Exonic
1166131908 19:40750703-40750725 TGGGCTTTCAGGGAGTGGGGCGG + Intronic
1167104159 19:47420472-47420494 GGGGCCTAACTGGAGTGGGGAGG + Intergenic
1167575424 19:50315434-50315456 TGGGCGGCAGGGGCGTGGGGAGG + Intronic
1167874596 19:52401138-52401160 TGGAATTCAGGGGAGAGGGGTGG - Intronic
1168241699 19:55092099-55092121 TGGGCTTCACTTGAGGGGCGGGG - Intronic
1168333900 19:55586048-55586070 GAGGCTGCACGGGAGAGGGGGGG - Intergenic
925664173 2:6235820-6235842 CTGCCTTCATGGGAGTGGGGAGG - Intergenic
927145608 2:20163717-20163739 TGGGGTTCAGGGTAGTGGTGTGG + Intergenic
927636262 2:24819576-24819598 TGGGCTTTCCGGGACTGTGGAGG - Exonic
927904292 2:26846559-26846581 TGGGCTTCAGGGAGGTGGCGTGG - Intergenic
932128572 2:69167404-69167426 TGGCCCTGAGGGGAGTGGGGTGG + Intronic
932597758 2:73104758-73104780 TGGGCTTCTTGGGAGAGGTGAGG - Intronic
932899857 2:75685058-75685080 TGGGGGTCAGGGGACTGGGGTGG + Intronic
935924238 2:108050185-108050207 TGCGGTTTACTGGAGTGGGGAGG + Intergenic
936373354 2:111921050-111921072 TGGGGGTAAAGGGAGTGGGGTGG + Intronic
937873551 2:126803551-126803573 TGGACTAGACGGGAGTGGGGTGG - Intergenic
937906639 2:127055802-127055824 CGGGCTTCCCGGCTGTGGGGTGG - Intronic
938056727 2:128221118-128221140 AGGCCATCACGGGAGTGCGGTGG - Intergenic
938322016 2:130372193-130372215 TGGGCAGGGCGGGAGTGGGGAGG - Intronic
938782237 2:134595255-134595277 TGGGGTTGGGGGGAGTGGGGAGG - Intronic
939345878 2:140965697-140965719 TGGGGTAGAGGGGAGTGGGGAGG - Intronic
939392926 2:141592059-141592081 TGGGGTTGAGGGGAGTGGTGGGG - Intronic
939473783 2:142659247-142659269 TGGACTTTATGGGGGTGGGGAGG + Intergenic
939770121 2:146305417-146305439 GGGGCTTCAGGGGGGTGGTGCGG - Intergenic
942222114 2:173780506-173780528 TGGGCTGCCCGGGGGAGGGGTGG + Intergenic
942574968 2:177353621-177353643 TGGGCTTTAGGGGACTTGGGGGG - Intronic
947915160 2:233827558-233827580 TGGGCCTGTTGGGAGTGGGGTGG + Intronic
948365029 2:237449215-237449237 CGGTCCTCCCGGGAGTGGGGAGG - Intergenic
949027568 2:241773687-241773709 TGGACCTCAGGGGTGTGGGGAGG + Intergenic
1169309908 20:4527402-4527424 TGGGATTTACTGGAGTGGGCCGG - Intergenic
1170766268 20:19292058-19292080 TGGGCATCACAGGCCTGGGGAGG + Intronic
1171457240 20:25278934-25278956 CAGGCTTCTCGGGGGTGGGGTGG + Intronic
1171869564 20:30514235-30514257 GGGGCTGCAGGGGAGGGGGGAGG + Intergenic
1173844174 20:46177707-46177729 TGGGCTACACGTGAATGGGGTGG + Intronic
1175788116 20:61724460-61724482 TGGGCTCCACGGGAGTGCAGGGG - Intronic
1176305240 21:5119718-5119740 TGGGCCTGTCGGGAGTGGGTAGG - Intronic
1178332062 21:31706535-31706557 TGGGTATCACGGCAGTGGGGAGG - Intronic
1179305083 21:40146252-40146274 TGGGCTTGACGGAGGGGGGGAGG + Intronic
1179851814 21:44142312-44142334 TGGGCCTGTCGGGAGTGGGTAGG + Intronic
1179987215 21:44928559-44928581 TGGCCTTCATGGGGGTGGGGAGG - Intronic
1180188886 21:46153454-46153476 TCGGCTTCAGGGGAGGGGGTTGG - Intronic
1180230626 21:46424777-46424799 TGGGGTTGAGGGGAGCGGGGTGG - Intronic
1181036365 22:20171636-20171658 AGGGCTGGAGGGGAGTGGGGAGG + Intergenic
1181456917 22:23065013-23065035 TGGGCTGCAGGGCAGTGGCGAGG - Intronic
1181625175 22:24118239-24118261 TGGGCTGCAGGGGAGCAGGGAGG + Intronic
1182238500 22:28895773-28895795 TGGGGTTCTCGGGGGAGGGGTGG + Intronic
1182464805 22:30508065-30508087 TGAGCTTCAGGGGTGGGGGGCGG - Intergenic
1184197420 22:42939531-42939553 TTGGCTCCACTGGAATGGGGAGG - Intronic
1184408229 22:44312294-44312316 TTGGCTTCACGGGGGTGAGGTGG - Intronic
1184887520 22:47355397-47355419 TGGGCTTCTTGGGAGAAGGGAGG + Intergenic
1185062880 22:48616149-48616171 GGGGCTGCTCAGGAGTGGGGTGG + Intronic
1185128613 22:49025230-49025252 GGGGCAGCCCGGGAGTGGGGAGG + Intergenic
1185225897 22:49652253-49652275 TGGCCGTCACAGGAGTGGAGAGG + Intronic
950101395 3:10358991-10359013 TGGGCATCACGAGGGTGGGGAGG - Intronic
952619810 3:35324203-35324225 TGGGGTTTACTTGAGTGGGGAGG + Intergenic
952879516 3:37974728-37974750 TGGGCTTCAAGGAAGTGGATGGG + Intronic
953032102 3:39185891-39185913 TGGGCCTCCCTGGAGTGGGCGGG + Exonic
953863295 3:46563524-46563546 TGGGTTCCAGGGGTGTGGGGAGG - Intronic
954073149 3:48157973-48157995 TGGGCTCCACAGGATGGGGGAGG - Exonic
954673418 3:52302786-52302808 TGGGCTTCACTTGGGTGGGCTGG - Intergenic
954756678 3:52844102-52844124 TGGGCTTCAGGGGGCTGGAGGGG + Intronic
955411340 3:58657572-58657594 CTGGCTTCAGGGCAGTGGGGTGG + Intronic
956103828 3:65796090-65796112 TTGGCTTCACAGGACTGCGGAGG + Intronic
960456882 3:117883107-117883129 TGGGGTTGGGGGGAGTGGGGAGG + Intergenic
960726989 3:120680673-120680695 TGGATTTCAGGGGAGTGGGCAGG - Intronic
961345611 3:126261364-126261386 TGGGCTTGGCGGGAGTGAGGGGG - Intergenic
962264439 3:133935224-133935246 TGGGCTTGAGGGGACTGGGCAGG - Intronic
962808763 3:138945151-138945173 TGGACTGCACGGCAGTCGGGCGG + Exonic
968481477 4:834967-834989 TGTGGTTCCCTGGAGTGGGGTGG + Intergenic
968494241 4:906725-906747 TGGCCTTCAGGGGTGTGGAGTGG - Intronic
969254330 4:5992119-5992141 TGGGCTTCAAGGGAAGGGGGCGG + Intergenic
969296897 4:6275579-6275601 GGGGATGCACGGGGGTGGGGTGG + Intronic
969584474 4:8084027-8084049 TGGGGGTCAGGGGAGTAGGGGGG + Intronic
970194681 4:13542601-13542623 CAGGGGTCACGGGAGTGGGGCGG + Intronic
973221615 4:47732891-47732913 TGGGGGTCACGGGAGTGGGAAGG - Intronic
974269241 4:59628737-59628759 TGGGGTAGAGGGGAGTGGGGAGG + Intergenic
974947771 4:68548424-68548446 TGGGGGTAGCGGGAGTGGGGAGG + Intronic
981653758 4:147088907-147088929 TGGTTTTCACAGGAGTGTGGAGG - Intergenic
982258564 4:153473425-153473447 TGGGTTTCCCGTGAGTGGGTAGG + Intronic
984832364 4:183987532-183987554 TGGGATTCATGGGATTTGGGGGG - Intronic
1202750317 4_GL000008v2_random:215-237 TGGACTGCAGGGGAGTGGAGTGG + Intergenic
1202750496 4_GL000008v2_random:1458-1480 TGGGGTTGACTGGAGTGGAGTGG + Intergenic
985512133 5:318885-318907 TTGGCTTCACAGAAGTGTGGGGG - Intronic
985650670 5:1105829-1105851 TGGTCTTCAGGGCAGTGGGCTGG - Intronic
999334212 5:150701034-150701056 GGGGCTTGACGGGATTGTGGCGG - Exonic
1001696055 5:173670871-173670893 TGGGATTCACGGGCGTGGGCAGG + Intergenic
1001868716 5:175131351-175131373 AGGGCCTCAAGGGAGTGAGGAGG - Intergenic
1001915660 5:175558037-175558059 AGGGTTTCATGGGGGTGGGGAGG + Intergenic
1002086701 5:176780464-176780486 TGGGGGGCACTGGAGTGGGGAGG - Intergenic
1002900510 6:1406471-1406493 TTGGCTCCCCGGGAGTGAGGCGG + Intergenic
1003139316 6:3457243-3457265 CGGGATCCACGGGAGGGGGGCGG + Intergenic
1003345450 6:5261638-5261660 TGGGCTTCCCGGGCGAGCGGTGG + Intronic
1003443434 6:6164323-6164345 TGGGGTCTACTGGAGTGGGGAGG + Intronic
1003632681 6:7802371-7802393 TGGGCCTCAAGGGAGAGGTGAGG - Intronic
1006163057 6:32049259-32049281 TGGGCATCACGGGTGAGTGGGGG - Intronic
1007381185 6:41491321-41491343 TGGGCGTCATGGGGGTGGGGCGG + Intergenic
1007472470 6:42099711-42099733 TGGGCTTCACAAGAGAGGTGGGG + Intergenic
1007872283 6:45053951-45053973 TGGTCTTCAGGGGAGAAGGGAGG - Intronic
1008752963 6:54758545-54758567 TGTGCTTCAGGGGATGGGGGAGG + Intergenic
1012535779 6:100295198-100295220 TGGGTTGCAGGGAAGTGGGGAGG - Intergenic
1012596556 6:101048051-101048073 GGGGCTTCTCGGGGGTGTGGAGG - Intergenic
1016381325 6:143484522-143484544 TGTGGTTCACTGGAGTAGGGGGG + Intronic
1016987015 6:149903414-149903436 TGGGATTGGCGGGAGTGGGTGGG - Intergenic
1017824448 6:158071247-158071269 ATGGCTGCACAGGAGTGGGGTGG + Intronic
1018618914 6:165712119-165712141 TGGGCTCCACCGTAGTGGTGTGG + Intronic
1018849542 6:167577129-167577151 GGGGCTGCACGGGAGTCTGGGGG - Intergenic
1019348331 7:541362-541384 TGGGCTTCCTGTGGGTGGGGTGG - Intergenic
1019422690 7:958416-958438 TGGGCTTCCCTGGAGGGGGCCGG - Intronic
1022351093 7:29566434-29566456 TGGGCTCCCCGGGAGCGGGCTGG - Exonic
1024226078 7:47327840-47327862 TGGGCTCCAGTGGAGGGGGGTGG - Intronic
1026831528 7:73613156-73613178 TGGGCTTCACGGGAGTGGGGAGG - Intronic
1028730590 7:94143685-94143707 TGGGGTTGATGGGAGTAGGGAGG - Intergenic
1032591698 7:133198035-133198057 TGGGCTTCACGGAGGTGTGAGGG - Intergenic
1032717755 7:134525326-134525348 TGGGCTTCACTGGGGTGGACTGG - Intergenic
1033510181 7:142052915-142052937 GGGGGTTCACGGGTGTGGAGGGG - Exonic
1034146410 7:148876805-148876827 TGTTCTTCAGGGAAGTGGGGTGG + Intronic
1034782032 7:153889149-153889171 TTGTCGTCTCGGGAGTGGGGAGG - Intronic
1035009157 7:155697141-155697163 TGGGGTTCTGGGGAGAGGGGAGG + Intronic
1035768700 8:2129392-2129414 GGGCCCTCACGGCAGTGGGGAGG + Intronic
1036613326 8:10368528-10368550 TGGCCAACACCGGAGTGGGGTGG + Intronic
1038451595 8:27642893-27642915 TGGGGTTCAGGGGAGTCGGGGGG + Intronic
1039027009 8:33269249-33269271 TGGGGATGAGGGGAGTGGGGTGG - Intergenic
1039352235 8:36775425-36775447 TGGGGTTGGGGGGAGTGGGGAGG + Intergenic
1039800105 8:40946697-40946719 TGGACTTCACGGTAGGGTGGTGG - Intergenic
1042284472 8:67092946-67092968 GGTGCTTCAGGGGAGTGGGTTGG + Intronic
1043704086 8:83327251-83327273 TGGGCTTCAAATGAGTGGTGAGG + Intergenic
1048433190 8:134389975-134389997 TGTGCAGCACGGGAGTGGAGAGG + Intergenic
1049178080 8:141206263-141206285 TCGGCCAGACGGGAGTGGGGCGG - Intergenic
1049665593 8:143841254-143841276 GGGGATTCGCGGGGGTGGGGCGG - Intergenic
1052930101 9:34049035-34049057 TTGGCTTCGCGGGGTTGGGGTGG - Intergenic
1052974489 9:34401014-34401036 TGGGGTTCACGGACTTGGGGGGG + Exonic
1053434608 9:38067031-38067053 AGGGCTTCACAGGAGTGTGAAGG + Intronic
1056789228 9:89615002-89615024 TGGGCTTCCCAGTTGTGGGGTGG - Intergenic
1057216386 9:93231123-93231145 TGGGCTCCAAGGGCCTGGGGAGG - Intronic
1057582336 9:96298591-96298613 GGGGCTTCAAGGGCGTGGGCTGG - Intronic
1058573206 9:106370606-106370628 TGAGCTTGGCGGGAGTGGGGCGG + Intergenic
1058991326 9:110256917-110256939 TGGGGTTCACGTGGCTGGGGGGG - Intergenic
1059642109 9:116227499-116227521 TGGGCTGCAGGGCATTGGGGAGG - Exonic
1060042344 9:120310270-120310292 TGGGGTCCTAGGGAGTGGGGAGG - Intergenic
1060521151 9:124294843-124294865 TGGGCTGCAGGGGAGTGTGGAGG + Intronic
1061652507 9:132062300-132062322 TGGGCAACACGGGAGCGGGCAGG + Intronic
1061714399 9:132509850-132509872 TGGGCTTCCTGGGAGTGGAAGGG - Intronic
1062292554 9:135803353-135803375 TGGAGCTCACGGGGGTGGGGCGG - Intergenic
1062413739 9:136437751-136437773 TGGGCACCATGGCAGTGGGGTGG + Intronic
1186461626 X:9752904-9752926 TGGGCGTGGCTGGAGTGGGGAGG + Intronic
1189214468 X:39311249-39311271 TGGGGTTAAAGGGACTGGGGAGG + Intergenic
1190120962 X:47658930-47658952 TGGGCTCCTGGGGAGTGGGGAGG + Exonic
1191976406 X:66876739-66876761 TGGGCATGATGGGAGTGGGCAGG + Intergenic
1192448984 X:71231018-71231040 TGGGATTCAGGGCAGCGGGGAGG + Intergenic
1195112136 X:101659202-101659224 TGGGCTTCACGGGAGGTGGGGGG - Intronic
1197806388 X:130402236-130402258 AGGGCTTCACGGTGGCGGGGGGG - Exonic
1198972391 X:142297194-142297216 TTTGCTTCACGGAAGTAGGGTGG + Intergenic
1201133185 Y:10970914-10970936 TGGAGTTCAGTGGAGTGGGGAGG - Intergenic