ID: 1026833633

View in Genome Browser
Species Human (GRCh38)
Location 7:73624259-73624281
Sequence CCGTGGGGCCCTCCGACTTC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026833633_1026833642 1 Left 1026833633 7:73624259-73624281 CCCGAAGTCGGAGGGCCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1026833642 7:73624283-73624305 CCCCTCCTGGTCGCGCCGCCGGG 0: 1
1: 0
2: 1
3: 11
4: 128
1026833633_1026833649 20 Left 1026833633 7:73624259-73624281 CCCGAAGTCGGAGGGCCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1026833649 7:73624302-73624324 CGGGGCAGCGAGTCGCTGTGCGG 0: 1
1: 0
2: 1
3: 1
4: 89
1026833633_1026833640 0 Left 1026833633 7:73624259-73624281 CCCGAAGTCGGAGGGCCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1026833640 7:73624282-73624304 ACCCCTCCTGGTCGCGCCGCCGG 0: 1
1: 0
2: 1
3: 5
4: 69
1026833633_1026833644 2 Left 1026833633 7:73624259-73624281 CCCGAAGTCGGAGGGCCCCACGG 0: 1
1: 0
2: 0
3: 3
4: 72
Right 1026833644 7:73624284-73624306 CCCTCCTGGTCGCGCCGCCGGGG 0: 1
1: 0
2: 1
3: 8
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026833633 Original CRISPR CCGTGGGGCCCTCCGACTTC GGG (reversed) Exonic
902873642 1:19328497-19328519 CCCTGGGGGCCTTCGACTCCTGG - Intronic
914360569 1:146932615-146932637 CCGTGGGCCCATCGGTCTTCCGG - Intergenic
914492017 1:148158024-148158046 CCGTGGGCCCGTCGGTCTTCCGG + Intergenic
1063636656 10:7788490-7788512 CCAGGTGGCCCTCCGACCTCAGG - Intronic
1063977607 10:11429798-11429820 CCGTGGGACCCACCCAGTTCTGG + Intergenic
1073062459 10:100740829-100740851 CCGTGAGGCCCTGGTACTTCTGG - Intronic
1075091100 10:119444550-119444572 CCTTGGGGCCCTCCTCCTTATGG + Intronic
1077222010 11:1422017-1422039 CCGTGGGGCACCCCAACCTCAGG - Intronic
1081991318 11:47339167-47339189 CTGTGGGGCCCTCACACCTCAGG - Intronic
1083847674 11:65345467-65345489 CCGTGGGGCTCTCTAGCTTCTGG - Intronic
1084391936 11:68883012-68883034 CCCTGGGGGCCTCAGACTCCTGG - Intergenic
1084533986 11:69746144-69746166 CCGTGGAGCCCACCGACCTCAGG - Intergenic
1087281786 11:96219066-96219088 CCCTGGGGCCATCCGGCTCCGGG + Intronic
1088347402 11:108843304-108843326 ACGTGGGTCCCTCCATCTTCAGG + Intronic
1091297132 11:134481942-134481964 CCCTGGGGCCCTGCCTCTTCAGG + Intergenic
1096095950 12:48935840-48935862 ACATGGGGCCCTCCAAGTTCAGG + Exonic
1101199483 12:102419647-102419669 CTGAGGCGCCCTCCGACTGCTGG + Exonic
1106764932 13:32904045-32904067 CCATGTGTCCCTCCTACTTCTGG - Intergenic
1121304744 14:92899016-92899038 CCGTGCGCCCCTCCGCCTCCCGG - Intergenic
1122387580 14:101359503-101359525 CCGTGGAGCCCTCCAAGTGCTGG - Intergenic
1122912830 14:104841677-104841699 CCCTGGGGCCCTCACACCTCTGG + Intergenic
1124636197 15:31366421-31366443 CCCTGGGGCCCTCCCACCTGGGG + Intronic
1130259431 15:82344051-82344073 CCCTGGGGCCCTCCCAGGTCTGG - Intronic
1131559112 15:93424156-93424178 CCTTGGAGCCCTCCTGCTTCGGG - Intergenic
1133305319 16:4804671-4804693 CCTTGGGGCCCTCCAACCTCAGG - Exonic
1148637326 17:49158824-49158846 CCTTGGGGCCCTAGGACTTGGGG + Intronic
1153410036 18:4782833-4782855 CCATAGGGACCTCAGACTTCCGG + Intergenic
1153614009 18:6917508-6917530 CCGAGGGGCTCTCAGACTTTAGG + Intergenic
1160223845 18:76997370-76997392 CCCTGGGGCCCTGGGGCTTCTGG + Intronic
1163556930 19:17998381-17998403 CCGTGGCCCCCTCGGACTGCGGG + Exonic
1165443489 19:35844130-35844152 CCGCGGTGCCCTCAGAGTTCTGG + Exonic
1166830999 19:45639491-45639513 CGGTGGGACCCTCCGGCTCCAGG - Intronic
926095757 2:10080023-10080045 CCGTGGCGCCCCCCGACGGCAGG - Exonic
927864779 2:26581434-26581456 CCAAGGGGCCCTCTGACTCCTGG + Intronic
932412579 2:71555994-71556016 CCGTGGAGCACTGCGCCTTCAGG - Exonic
943401442 2:187415978-187416000 CCCTAGGCCCCTCCGTCTTCAGG - Intronic
949012175 2:241687025-241687047 CCGTGCGGGCCTCCGTCCTCGGG + Intergenic
1169262915 20:4150509-4150531 CCCTGGGGCCCTCCAACATTTGG - Intronic
1176672958 21:9751430-9751452 CCATGGGGCCCTAGGACTTAGGG + Intergenic
1178096773 21:29223402-29223424 CCCTAGGCCCCTCCCACTTCAGG - Intronic
1178467000 21:32858213-32858235 CCTTGGGGCCCTGTGATTTCTGG - Intergenic
1181098080 22:20519877-20519899 CCCTGGGGGCCTCCTCCTTCTGG + Intronic
1184247950 22:43245136-43245158 CCGAGGGGCCCTCTGAACTCCGG + Intronic
952388571 3:32860669-32860691 CCGTGGGGCCCACCTTCCTCAGG + Intronic
952885986 3:38011166-38011188 CAGTGCGGCCCTGCGACTGCAGG + Intronic
961382963 3:126507988-126508010 CCGTGGGGCACTGCGGCTGCTGG + Exonic
961466472 3:127084867-127084889 CTCTGGGGCCCACTGACTTCAGG - Intergenic
962476736 3:135761595-135761617 CCATGGGGCCCTTAGACTTCAGG + Intergenic
966971671 3:185050538-185050560 TCGAGGTGCCCTCCGACCTCTGG - Intronic
974716063 4:65669844-65669866 CCTTGGGGTCCTACGCCTTCTGG + Exonic
976565521 4:86547389-86547411 CGGTGGGGCCGGCCGACTGCTGG - Intronic
978277551 4:106969873-106969895 CTGTGGGGCCTTCCTACTCCAGG + Intronic
980715498 4:136623551-136623573 CTGTAGGGCCCTTCCACTTCTGG - Intergenic
985129749 4:186727164-186727186 CTTTGTGGCCCTCCAACTTCTGG + Intergenic
985316227 4:188661248-188661270 CCGTGGGTCCCACTGTCTTCAGG + Intergenic
985401731 4:189600198-189600220 CCATGGGGCCCTAGGACTTAGGG - Intergenic
985512584 5:320989-321011 CCGCCGGCCCCTCCGACCTCGGG - Intronic
987282325 5:16424196-16424218 CCTTGTGGTCCTCCGTCTTCAGG + Intergenic
992939953 5:81751541-81751563 CCGTGGCGGCCCCAGACTTCGGG + Intronic
999265690 5:150265361-150265383 CCGCTGGGCCCTCTCACTTCAGG + Intronic
1007819948 6:44553859-44553881 CCGTGGGCTCCTTGGACTTCTGG + Intergenic
1017891320 6:158642169-158642191 CAGTGCTGCCCTCCGACTCCAGG + Intronic
1026833633 7:73624259-73624281 CCGTGGGGCCCTCCGACTTCGGG - Exonic
1027228907 7:76261064-76261086 CCGTTGGAGCCTCTGACTTCTGG + Intronic
1029599214 7:101553926-101553948 CTGTGGGGACCTGCGGCTTCTGG + Intronic
1035382233 7:158447491-158447513 CCCTGGGGCCCTGCTGCTTCTGG - Intronic
1035388662 7:158490616-158490638 CCCTGGGGCCCTCCCGGTTCTGG - Intronic
1035712457 8:1729205-1729227 CCGAGGGGCCCTCCGTGTGCAGG + Intergenic
1036420217 8:8588623-8588645 CAGTGGGGCCCCCAGAATTCTGG - Intergenic
1048954666 8:139525939-139525961 ACGTGGGTCCCTGGGACTTCAGG - Intergenic
1061809456 9:133153959-133153981 CCGTGGGGCCCTGAGACCTTGGG - Exonic
1062146471 9:134992334-134992356 CCGGGGGGCCTTCCTCCTTCCGG - Intergenic
1062527850 9:136985485-136985507 CCGCGGGGCCCTCTACCTTCGGG + Exonic
1062564227 9:137156816-137156838 CCGTGGGGTCCTCCCCGTTCGGG - Intronic
1062735374 9:138134535-138134557 CCGTGGGGCCCAGTGCCTTCTGG + Intergenic
1189952683 X:46248661-46248683 CCTTGGGCCCCTTAGACTTCTGG + Intergenic