ID: 1026836762

View in Genome Browser
Species Human (GRCh38)
Location 7:73644869-73644891
Sequence CCATCAGGGCATCAGGCCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026836754_1026836762 -10 Left 1026836754 7:73644856-73644878 CCCCATGCCGGCCCCATCAGGGC No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836746_1026836762 13 Left 1026836746 7:73644833-73644855 CCTCTCCCCTGCTGGATAACTGG No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836750_1026836762 6 Left 1026836750 7:73644840-73644862 CCTGCTGGATAACTGGCCCCATG No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836749_1026836762 7 Left 1026836749 7:73644839-73644861 CCCTGCTGGATAACTGGCCCCAT No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836748_1026836762 8 Left 1026836748 7:73644838-73644860 CCCCTGCTGGATAACTGGCCCCA No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836743_1026836762 27 Left 1026836743 7:73644819-73644841 CCAGAATCTCCTGGCCTCTCCCC No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836742_1026836762 28 Left 1026836742 7:73644818-73644840 CCCAGAATCTCCTGGCCTCTCCC No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data
1026836745_1026836762 18 Left 1026836745 7:73644828-73644850 CCTGGCCTCTCCCCTGCTGGATA No data
Right 1026836762 7:73644869-73644891 CCATCAGGGCATCAGGCCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026836762 Original CRISPR CCATCAGGGCATCAGGCCCC TGG Intergenic
No off target data available for this crispr