ID: 1026841539

View in Genome Browser
Species Human (GRCh38)
Location 7:73671955-73671977
Sequence GGTGAGAGTGGGCCATACCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 130}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026841534_1026841539 -1 Left 1026841534 7:73671933-73671955 CCAGGGGCTTCTGACCTGTGCAG 0: 1
1: 0
2: 1
3: 23
4: 281
Right 1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG 0: 1
1: 0
2: 2
3: 13
4: 130
1026841532_1026841539 15 Left 1026841532 7:73671917-73671939 CCTGGGGCAAGGTAGGCCAGGGG 0: 1
1: 0
2: 1
3: 32
4: 324
Right 1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG 0: 1
1: 0
2: 2
3: 13
4: 130
1026841528_1026841539 21 Left 1026841528 7:73671911-73671933 CCAGACCCTGGGGCAAGGTAGGC 0: 1
1: 0
2: 2
3: 12
4: 214
Right 1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG 0: 1
1: 0
2: 2
3: 13
4: 130
1026841530_1026841539 16 Left 1026841530 7:73671916-73671938 CCCTGGGGCAAGGTAGGCCAGGG 0: 1
1: 0
2: 2
3: 30
4: 293
Right 1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG 0: 1
1: 0
2: 2
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026841539 Original CRISPR GGTGAGAGTGGGCCATACCC AGG Exonic
900323143 1:2094875-2094897 GGAGAGAGAGGGCCAAAACCAGG - Intronic
903003296 1:20281765-20281787 AGTGAGAGTGGCCCACACCAAGG - Intergenic
903263928 1:22145135-22145157 GGTGAGAGTGGCCCCTGCCCTGG - Intergenic
903653448 1:24934682-24934704 GGCTAGAGAGGGCCAGACCCGGG + Intronic
906588445 1:47001428-47001450 GGTGAGGATGGGCCATAATCAGG + Intergenic
907792653 1:57682588-57682610 GGTGAGAATGGGCTATCCCTTGG - Intronic
917232999 1:172857971-172857993 GGTGAGAGAGGACCAGAGCCAGG - Intergenic
1064550864 10:16499580-16499602 GGTGAGGGTGGTGCACACCCGGG - Intronic
1067848089 10:49738737-49738759 GGTGAGGGTGGGCGAGGCCCAGG - Intronic
1073344970 10:102776169-102776191 GGTGGGGGTGGGCCAGAGCCAGG + Intronic
1073771380 10:106739158-106739180 GGGAAGAGTGGGCCAAACTCTGG - Intronic
1074787792 10:116856635-116856657 GGTCAGAGGGTGCCATCCCCTGG - Exonic
1075546823 10:123361449-123361471 GGTGAGAGATGGGCAAACCCCGG + Intergenic
1077614053 11:3662343-3662365 GGTGGGAATGGGCCATTTCCAGG + Intronic
1083658363 11:64241132-64241154 GGTGAGCGGGGGCCACAGCCCGG + Intronic
1083703670 11:64498401-64498423 GGTGTCAGGGAGCCATACCCTGG + Intergenic
1083714708 11:64568631-64568653 GGTGAGAGTGGGGTTTGCCCTGG - Intronic
1083836287 11:65270673-65270695 GGTGAGAGGTGGCCAGATCCTGG - Intronic
1084175343 11:67419838-67419860 GGTGAGCGTGGCCCAGGCCCAGG + Exonic
1084502309 11:69542078-69542100 GGAAAGAATGGGCCATGCCCAGG - Intergenic
1084566364 11:69931129-69931151 GGTGGGGGTAGGCCACACCCAGG - Intergenic
1084881099 11:72172266-72172288 GGTGAGAGGGAGCCCTTCCCCGG - Intergenic
1085454668 11:76659094-76659116 GGTGAGGGAGGGCCAAGCCCAGG - Exonic
1097372041 12:58796068-58796090 GGTGGGAGAGGGCCACAGCCTGG + Intronic
1099986155 12:89667104-89667126 GGTGAGAGTGGGCCATTAGGAGG - Intronic
1107127114 13:36857660-36857682 GGTGAGAGTGTGCCAATCTCTGG + Intronic
1108773802 13:53737964-53737986 GGTGAGAGTTGGGCATCCTCAGG + Intergenic
1112371353 13:98796494-98796516 GGAGACAGTGTCCCATACCCAGG - Intronic
1114080292 14:19197886-19197908 GGGGAAAGTGTGGCATACCCAGG + Intergenic
1115290139 14:31761474-31761496 GGTGAGAGTGGGCAAGGCCAGGG - Intronic
1117733926 14:58750925-58750947 GGTGGGAGGGGGCCTTTCCCAGG - Intergenic
1121639543 14:95475908-95475930 GGTGGGAGTGGGCCTGTCCCAGG - Intergenic
1128099807 15:64989643-64989665 GGTGAGGGTGGGCGAAGCCCTGG - Exonic
1128370896 15:67038452-67038474 GGGGAGGGTGGGGCATATCCTGG - Intergenic
1128371175 15:67040479-67040501 GGGGAGGGTGGGGCATATCCTGG - Intergenic
1129760636 15:78127409-78127431 GGAGAGAGGGGGCCTAACCCAGG + Intronic
1130112555 15:80977710-80977732 GGGGAGAGAGCGCCACACCCTGG - Exonic
1131194961 15:90348386-90348408 TGTGGTAGTGGGCCATACCTGGG - Intergenic
1139597155 16:67964710-67964732 GGTGTGATTGGGCCATGCACTGG + Intronic
1141032376 16:80601239-80601261 GCTGAGAGTGAGCCATCACCGGG + Exonic
1142245137 16:88966876-88966898 GGTGGGTGTGGGCCCTATCCCGG - Intronic
1142379402 16:89722935-89722957 GGGGGGAATGGGCCATGCCCGGG + Intronic
1142381825 16:89737130-89737152 TATGAGAGGGGTCCATACCCAGG - Intronic
1144538034 17:16111101-16111123 GGTGAGAGAGGGACATACACTGG - Intronic
1144738505 17:17568257-17568279 GGTGATGGTGGGCCATAGGCAGG - Intronic
1144849158 17:18235387-18235409 GGTCAGAATGTGCCATACTCGGG + Intronic
1146950171 17:36900180-36900202 GGTGGGAGTGGGCCATGGCCTGG - Intergenic
1147358931 17:39919125-39919147 GGTGAGTGTGGGCCAGACAATGG + Intronic
1148282974 17:46363243-46363265 TGTGGGAGTGGGACAGACCCAGG - Intergenic
1148305191 17:46581168-46581190 TGTGGGAGTGGGACAGACCCAGG - Intergenic
1149065409 17:52473505-52473527 GGTGGGAGTGGGTCCTACACGGG + Intergenic
1152212267 17:79009045-79009067 GGTGGGAGGGGGTCATTCCCAGG + Intronic
1152242088 17:79166121-79166143 GGTGGGCGTGGGCCAAGCCCAGG - Intronic
1154204787 18:12327285-12327307 GGTCAGAGTGGGCTCTGCCCAGG - Intronic
1155786973 18:29913874-29913896 AGTGAGACTGGGTCTTACCCAGG - Intergenic
1156362994 18:36400693-36400715 GCTGAGAGCAGGCCTTACCCTGG + Intronic
1157517365 18:48320551-48320573 GGTGAGAAGCGGCCAAACCCCGG + Intronic
1160110906 18:76029135-76029157 GGTGAGAGTTGGCCACACCAGGG - Intergenic
1161577006 19:5059910-5059932 GGTGGGAGTGAGCCACACGCAGG - Intronic
1162308380 19:9889659-9889681 GGAGGCAGTGGGCCAGACCCAGG + Intronic
1162429910 19:10622181-10622203 GCTGAGCGTGGGACGTACCCAGG + Intronic
1162818624 19:13210076-13210098 GGTGGGGGTGGGGGATACCCAGG + Intronic
1163166798 19:15503943-15503965 GGAGAGAGAAGCCCATACCCAGG - Intergenic
1163395257 19:17056305-17056327 GGTGGGAGTGGGCCATGCCGGGG - Intronic
1163673855 19:18645423-18645445 AGTGAGCCTGGGCCCTACCCAGG - Intronic
1163755105 19:19101886-19101908 GGTAAGTGTTGGCCATCCCCAGG + Exonic
1163987735 19:20968980-20969002 GGTGAGAGTGCGACATACCTGGG + Intergenic
1164649346 19:29880858-29880880 GGTGTGAGTGTGCCGCACCCTGG + Intergenic
1166561237 19:43733638-43733660 GGTGGGAGTGGGCCATGAGCTGG + Exonic
1166566211 19:43767137-43767159 AGTGAGAGTGGGACACACCGAGG + Intronic
1167314636 19:48756471-48756493 AGTGAGTGTGGGCCAGAGCCTGG + Exonic
925759207 2:7168171-7168193 GGTGAGAGTGGTCAAAGCCCAGG + Intergenic
928111032 2:28508973-28508995 AGTGAGAGAGGGCCATACACAGG - Intronic
937011310 2:118565259-118565281 GGTGAGAGTGGGCAGGAGCCTGG - Intergenic
938214053 2:129492981-129493003 GGTGAGACCTGGCCAAACCCTGG + Intergenic
939000489 2:136728427-136728449 GGTGAGTGAGGGACATCCCCTGG - Intergenic
939105477 2:137943777-137943799 GGTGAGAGAGGGCAATAACAAGG + Intergenic
945197586 2:207251639-207251661 AGTCACAGTGGGCCATATCCAGG - Intergenic
945735128 2:213589562-213589584 GATGGGAGTGGGCCCTACCCTGG - Intronic
946167434 2:217873554-217873576 GGTGAGAGAGAGCCAGCCCCTGG + Intronic
946385387 2:219381313-219381335 GGTGAGGGTGGGCCCTGCCTGGG - Exonic
948642792 2:239386027-239386049 GGGGAGGCTGGGCCAAACCCTGG + Intronic
1170818352 20:19734347-19734369 AGTGTGAGTGGGCCTTAACCCGG + Intergenic
1172942755 20:38665920-38665942 GGGGTGAGTGGGCGAGACCCCGG - Intergenic
1172973407 20:38889509-38889531 GGGGAGAGCGGGTCTTACCCGGG + Intronic
1175967005 20:62664786-62664808 GGTCAGAGTGGGCCAGACCCAGG - Intronic
1176202597 20:63869186-63869208 GGTGGGAGTGGGTGAGACCCTGG - Intronic
1177647386 21:23917368-23917390 GGTAGAAGTGGGCCATTCCCTGG + Intergenic
1181050360 22:20235434-20235456 GGTGAGAGAGGGCCCTGCCTGGG - Intergenic
1181345179 22:22214852-22214874 GGTGAGAGTGGACCTTACCCAGG + Intergenic
1182475320 22:30573916-30573938 TGGGAGAGTGGGACAAACCCTGG - Intronic
1182951425 22:34379861-34379883 GGTGAGAGTGGGGCAAGCCCAGG - Intergenic
1183096231 22:35553913-35553935 GGTGAGAGCGGGCCACACACCGG - Exonic
950500071 3:13358200-13358222 GGTGAGTGTGGGCTATGCTCGGG - Exonic
953131643 3:40145170-40145192 GGTGGAAGTGGCCCAGACCCTGG - Intronic
953246709 3:41199817-41199839 GGTGAGGGTGGGCCGCGCCCGGG + Intronic
954214477 3:49116816-49116838 GGAGAGACTGGGTCATTCCCGGG + Exonic
954690825 3:52394808-52394830 GGGGAGAGTGGGCTATCCCAGGG - Intronic
954700457 3:52448049-52448071 GGTGGGTGTGGGCAACACCCAGG - Intergenic
960193690 3:114739109-114739131 GCAGAGAATGGGCCATACCTGGG + Intronic
961008583 3:123421511-123421533 GGTCATAGTGGACCACACCCAGG - Intronic
961484783 3:127209117-127209139 GCTGAGAGTGGGCTATCCCTGGG + Intergenic
962901205 3:139763432-139763454 AGTGAGAGTGGCCCATAGCCTGG - Intergenic
963219787 3:142796500-142796522 CCTGAGAGAGGGCCCTACCCTGG - Intronic
965612256 3:170556898-170556920 GATGAGAGTGGGAGATAGCCTGG - Intronic
965633055 3:170752821-170752843 GGAGAGAGTGGGGCAAAGCCTGG + Intronic
968920987 4:3522224-3522246 GGGGAGGGTGGGCCATGTCCTGG + Intronic
969377604 4:6773200-6773222 GGGGAGAGTGGGCCACCCCAGGG - Intergenic
977265137 4:94844901-94844923 GATAATAGTGGGCCAGACCCTGG + Intronic
978850743 4:113332921-113332943 GGACATAGTGGGCCATCCCCTGG - Intronic
981233993 4:142393188-142393210 GGTGAGAGTGTGCAAAACTCAGG - Intronic
981562467 4:146062856-146062878 GGTAAGACTGGGCCCTCCCCTGG - Intergenic
985650334 5:1104612-1104634 GATGAGAGTGGGCCCCGCCCAGG - Intronic
986666395 5:10108431-10108453 GGTGAGGGTGGGCCCTGACCCGG - Intergenic
987837468 5:23179500-23179522 GGTGGGAGTGCCCCTTACCCAGG + Intergenic
990368594 5:55094506-55094528 GATGGGAGTGGGCCAACCCCTGG - Intergenic
995329036 5:110926044-110926066 GGTGACTGTGGGCAATACCTTGG + Intergenic
995659359 5:114463857-114463879 AGTGAGAAGGGTCCATACCCAGG + Intronic
1001131676 5:169069497-169069519 AGAGAGAGAGGGCCCTACCCTGG + Intronic
1001893557 5:175360156-175360178 GGCAAGAGGGGCCCATACCCTGG + Intergenic
1003460828 6:6326113-6326135 GGCAAGAGTGGGCTATGCCCAGG - Intergenic
1005203964 6:23379837-23379859 GCTGTGAGTGGGCCACACCCGGG + Intergenic
1010340448 6:74744987-74745009 GGCGAGTGTTGGCCATAGCCAGG - Intergenic
1010938976 6:81893451-81893473 GGTAACAGTGCTCCATACCCTGG - Intergenic
1012253747 6:97008654-97008676 GGTGAGAGCAGGCCATACCTTGG + Intronic
1015649598 6:135440939-135440961 GGAAAGAGTGGCCCATACACAGG + Intronic
1017545925 6:155450653-155450675 GGTGAGATATGGCCATGCCCAGG - Intronic
1018732160 6:166659392-166659414 GGGGAGAGGGGGCCATCCTCAGG + Intronic
1019636333 7:2078054-2078076 GGTGAGTGGGGGCCCTTCCCCGG - Intronic
1024301278 7:47889519-47889541 GATAAGAGTGGGCCATGCCATGG - Intronic
1026841539 7:73671955-73671977 GGTGAGAGTGGGCCATACCCAGG + Exonic
1034317241 7:150143878-150143900 GGTGAGAGTGGGCTGGAACCTGG + Intergenic
1034708499 7:153170142-153170164 TGTGAGAGTGGGACATAGCTGGG + Intergenic
1034775511 7:153823339-153823361 GGTGAGAGTGGGCTGGAACCTGG - Intergenic
1037885544 8:22594334-22594356 GGTGGGAGCAGGTCATACCCAGG - Intronic
1040725660 8:50378990-50379012 GGTGAAAGGGGGCAAGACCCTGG - Intronic
1044751724 8:95422849-95422871 GGTGACAGTGGGCCATGCAAGGG + Intergenic
1045305580 8:100953329-100953351 GGTGGGAGTGGGCCACAGGCCGG + Intronic
1045348648 8:101317536-101317558 GGAGAGAGTATGGCATACCCGGG - Intergenic
1047514786 8:125544713-125544735 GGTGAGGGTGAGCCAAAACCAGG - Intergenic
1050766681 9:9142997-9143019 GGAGAGAACGGGCCATTCCCAGG - Intronic
1051798862 9:20908306-20908328 GGTGAGAGTGGGGCATAGGATGG + Intronic
1060421120 9:123470367-123470389 GGTGAGAGTGAGGCAACCCCTGG - Intronic
1187959066 X:24550908-24550930 GGTGTGGGTGGGCCATGGCCAGG - Intergenic
1202329033 Y:23725642-23725664 AGTGATTGTGGGCCATACTCTGG - Intergenic
1202541738 Y:25944412-25944434 AGTGATTGTGGGCCATACTCTGG + Intergenic