ID: 1026843278

View in Genome Browser
Species Human (GRCh38)
Location 7:73682932-73682954
Sequence AAAGTTGAACATCGTGCGGT TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 23
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 20}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026843275_1026843278 3 Left 1026843275 7:73682906-73682928 CCGTAGTGGGCCTGGTAGAAGGC 0: 1
1: 0
2: 0
3: 3
4: 93
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843266_1026843278 20 Left 1026843266 7:73682889-73682911 CCCGCTCCAGTTGTTCCCCGTAG 0: 1
1: 0
2: 1
3: 5
4: 71
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843270_1026843278 14 Left 1026843270 7:73682895-73682917 CCAGTTGTTCCCCGTAGTGGGCC 0: 1
1: 0
2: 0
3: 0
4: 33
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843267_1026843278 19 Left 1026843267 7:73682890-73682912 CCGCTCCAGTTGTTCCCCGTAGT 0: 1
1: 0
2: 0
3: 3
4: 50
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843273_1026843278 4 Left 1026843273 7:73682905-73682927 CCCGTAGTGGGCCTGGTAGAAGG 0: 1
1: 0
2: 2
3: 11
4: 114
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843276_1026843278 -7 Left 1026843276 7:73682916-73682938 CCTGGTAGAAGGCGTCAAAGTTG 0: 1
1: 0
2: 0
3: 10
4: 115
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843265_1026843278 25 Left 1026843265 7:73682884-73682906 CCGTTCCCGCTCCAGTTGTTCCC 0: 1
1: 0
2: 1
3: 30
4: 628
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20
1026843272_1026843278 5 Left 1026843272 7:73682904-73682926 CCCCGTAGTGGGCCTGGTAGAAG 0: 1
1: 0
2: 0
3: 5
4: 88
Right 1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG 0: 1
1: 0
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026843278 Original CRISPR AAAGTTGAACATCGTGCGGT TGG Exonic
922597884 1:226827796-226827818 AAAGTTGAAAATTGTGTGGGAGG - Intergenic
1078570421 11:12453050-12453072 AAAGTTGAACGTGCTGTGGTGGG + Intronic
1100320546 12:93487572-93487594 AAAGTTGAACACCTTGAGGAAGG + Exonic
1106548987 13:30755278-30755300 AAGGTTAAACATTGTGCTGTGGG + Intronic
1117175307 14:53139760-53139782 AAAGTTGGACATCTTGTGGTGGG - Intronic
1118898691 14:69968589-69968611 AAATTTAAACATCTTGCTGTTGG - Intronic
1150604339 17:66678081-66678103 AAAGTTAAGCATCTTGAGGTGGG + Intronic
940861902 2:158779386-158779408 GAATTTGAACATCTTGAGGTGGG - Intergenic
1174823645 20:53749225-53749247 AAAGTAGAAAATAGTGCTGTTGG + Intergenic
1184152786 22:42648415-42648437 AAAGTTGACCATGGTGAGGCTGG - Intronic
960196602 3:114776173-114776195 AAAGGTAAACATGGTGTGGTGGG + Intronic
963568270 3:146959817-146959839 AATTTTGAACATTGTGCTGTGGG + Intergenic
972226833 4:37023206-37023228 AAAGTTGAACAAATTGAGGTGGG + Intergenic
1011048265 6:83111622-83111644 AACGATGAACATCTTGTGGTTGG + Intronic
1015713831 6:136170153-136170175 AAAGTTGAACATCGTATGGGTGG + Intronic
1017544471 6:155436224-155436246 AAAGCTGAACATAGTGCTTTTGG + Intronic
1026843278 7:73682932-73682954 AAAGTTGAACATCGTGCGGTTGG + Exonic
1034850007 7:154484622-154484644 AAAGTTGAACATGCTGCAGGGGG - Intronic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1045653020 8:104359631-104359653 AAAGTTGAAGAAAGTGCAGTTGG - Intronic
1056210150 9:84357757-84357779 GAAGTTGAACACCGAGCTGTGGG + Intergenic
1187278360 X:17836568-17836590 TAAGTTGAACATCGTTAAGTTGG + Intronic
1201184208 Y:11382928-11382950 AAAATTGAAGATCATGCGTTAGG + Intergenic