ID: 1026843698

View in Genome Browser
Species Human (GRCh38)
Location 7:73685061-73685083
Sequence CTGTGGGAGGCGGAGGTGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219332
Summary {0: 2, 1: 61, 2: 3617, 3: 63463, 4: 152189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026843686_1026843698 11 Left 1026843686 7:73685027-73685049 CCGGGCGCTATGGCTCATACCAG 0: 1
1: 3
2: 88
3: 2877
4: 36093
Right 1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG 0: 2
1: 61
2: 3617
3: 63463
4: 152189
1026843689_1026843698 -8 Left 1026843689 7:73685046-73685068 CCAGTAATCCCAGCCCTGTGGGA 0: 28
1: 5095
2: 303534
3: 268687
4: 209578
Right 1026843698 7:73685061-73685083 CTGTGGGAGGCGGAGGTGGACGG 0: 2
1: 61
2: 3617
3: 63463
4: 152189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026843698 Original CRISPR CTGTGGGAGGCGGAGGTGGA CGG Intronic
Too many off-targets to display for this crispr