ID: 1026846544

View in Genome Browser
Species Human (GRCh38)
Location 7:73701982-73702004
Sequence CCTTGGCAGGCAGTGTGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 468
Summary {0: 1, 1: 0, 2: 4, 3: 47, 4: 416}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026846544 Original CRISPR CCTTGGCAGGCAGTGTGCTG GGG (reversed) Intronic
900131535 1:1089331-1089353 CCATGGCAGCAAGAGTGCTGGGG - Intronic
900191432 1:1353866-1353888 ACTTGGCAGGCAGGGGGCTGTGG + Exonic
900340072 1:2184178-2184200 CCAGCGCAGGCAGGGTGCTGTGG + Intronic
900356316 1:2266489-2266511 TCTCGGGAGGCAGTGAGCTGGGG + Intronic
900745457 1:4357617-4357639 CCCTCGCAGGGAGTGTGATGAGG - Intergenic
900869065 1:5289014-5289036 CCTTTGTGAGCAGTGTGCTGAGG + Intergenic
901626296 1:10627113-10627135 ACGTGGCAGGCAGTGGGCAGTGG + Intronic
902361787 1:15945950-15945972 CCTTGGCTAGGGGTGTGCTGGGG - Intronic
902702625 1:18182993-18183015 CCTGGGCAGCCAGTTTGCAGCGG - Intronic
903063533 1:20685876-20685898 CGTGGCCAGGCAGTGTGCAGTGG - Intronic
903197475 1:21701926-21701948 GCTTGGCAATCAGTGTGCTCGGG - Intronic
903237910 1:21962215-21962237 CCCTGGCAGGGAAGGTGCTGGGG + Intergenic
903315741 1:22504381-22504403 GTGTGCCAGGCAGTGTGCTGAGG + Intronic
903834406 1:26193602-26193624 GCGTGCCAGGCACTGTGCTGGGG - Intronic
904523294 1:31112768-31112790 CCTTGTCAGGCAGTGGGGTGGGG + Intergenic
904623971 1:31791783-31791805 CCTTGAGAGGCAGTGTGGTGTGG + Intronic
904922299 1:34018051-34018073 CGTGGGCAGGCAGTGAGATGTGG - Intronic
905024445 1:34840093-34840115 CCTTGGCTGGCAGTCGGGTGAGG + Intronic
905234388 1:36535913-36535935 CAATTGCAGGCAGTGGGCTGTGG + Intergenic
905735970 1:40326016-40326038 CCTAGGCAGACAGAGTGCAGTGG - Intergenic
905885851 1:41491489-41491511 CCTTGGGATGCAGGGTGCTGTGG + Intergenic
905924134 1:41737919-41737941 ACTTGCCAGGCCCTGTGCTGGGG + Intronic
906114948 1:43350201-43350223 TTTTGGCAGGCACTGTGCTAAGG - Intronic
906118140 1:43368811-43368833 CTTTGGCAGCCAGTGTGAGGAGG + Intergenic
906222041 1:44088400-44088422 CCTAAGCAGGCTGGGTGCTGTGG - Intergenic
907073510 1:51558638-51558660 GCTTGGCAGGCGGGGTGCTAGGG - Intergenic
907707317 1:56844081-56844103 CTGTGCCAGGCAGTGTGCTGGGG + Intergenic
908538779 1:65103326-65103348 CCTTGGCAGCTGGTGTGATGTGG + Intergenic
909277801 1:73710168-73710190 CCTTGCCTGGCATTGTGCTGTGG + Intergenic
909681579 1:78297996-78298018 CCTTAGCAAGCAGTCTGATGTGG + Intergenic
911088298 1:93997993-93998015 ACTTCCCAGGCAGTGTGCAGAGG - Exonic
911475420 1:98367237-98367259 CCTTGGCAGGGCAGGTGCTGTGG - Intergenic
911854978 1:102865221-102865243 CTTTGGCAGGCAGAGGGCTAGGG + Intergenic
912273469 1:108232598-108232620 ACTGGGCAGGCAATGAGCTGGGG + Intronic
912294751 1:108461724-108461746 ACTGGGCAGGCAATGAGCTGGGG - Intronic
912435257 1:109656938-109656960 CCTTGCAAGGCAGAATGCTGGGG + Intronic
912436964 1:109668645-109668667 CCTTGCAAGGCAGAATGCTGGGG + Intronic
912439657 1:109688396-109688418 CCTTGCAAGGCAGAATGCTGGGG + Intronic
912442972 1:109712844-109712866 CCTTGCAAGGCAGAATGCTGGGG + Intronic
912716173 1:111985184-111985206 CCATCTCAGGCAGTCTGCTGAGG + Intronic
913145166 1:115981762-115981784 CCTTGGAAGGCATTCGGCTGGGG - Intronic
913195875 1:116455456-116455478 CCATGGGAGGCAGTGTGGGGTGG - Intergenic
913472902 1:119207542-119207564 TCTTTCCAGGCAGTGAGCTGGGG + Intergenic
913524907 1:119681673-119681695 AGCTGGAAGGCAGTGTGCTGGGG + Intronic
915095077 1:153456870-153456892 CCAGGCCAGGCAGTGTGCTATGG - Intergenic
918117356 1:181508669-181508691 CCTTGGCAGGCTGTATGTTGGGG + Intronic
918467623 1:184837347-184837369 CCTAGGGAGACAGAGTGCTGGGG + Intronic
920167223 1:204044480-204044502 CCTGGGTAGGGAGTGTGATGGGG + Intergenic
923085821 1:230703108-230703130 CCTTGCCAGGCACTGTGTTCTGG + Exonic
923648799 1:235852308-235852330 CCCTGACAGGCAGGGGGCTGGGG - Intronic
924185191 1:241481318-241481340 CTGTGGCAGGCACTGTGCTAGGG - Intergenic
924225338 1:241917299-241917321 CCATGTGAGGCACTGTGCTGGGG - Intergenic
924294916 1:242576985-242577007 GCTTAGGAGGCAGTGTGCAGAGG + Intergenic
924300612 1:242633833-242633855 CTCTGTCAGGCACTGTGCTGAGG + Intergenic
1062778031 10:171835-171857 CATTGAAAGGCAGTGTGGTGAGG - Intronic
1062782368 10:225850-225872 CCTGGGCAGCCAGCCTGCTGGGG + Intronic
1063214635 10:3913071-3913093 AAGTGGTAGGCAGTGTGCTGAGG - Intergenic
1063309624 10:4940108-4940130 TTTTGGCAGGCAGGGGGCTGAGG - Intronic
1063317672 10:5021995-5022017 TTTTGGCAGGCAGGGGGCTGAGG + Intronic
1063460120 10:6210079-6210101 CCTTGCCAGGGAGGGTGATGAGG + Intronic
1063977417 10:11428538-11428560 CCATGGCAGGCTGGGTGCGGTGG - Intergenic
1065630177 10:27671786-27671808 CCTTGGAAGGCGGTGTGTTGTGG - Intergenic
1065902569 10:30221865-30221887 CTTTGGCAGGGAATGTCCTGTGG - Intergenic
1066650790 10:37653003-37653025 GCATGGCAGGCAGTTTGCTAAGG + Intergenic
1067657353 10:48206301-48206323 CCTTTGCACGCAGTGTGCCAAGG - Intronic
1068089929 10:52421040-52421062 GTTTGGCAGGCAGTGGGCTAGGG - Intergenic
1068649556 10:59506777-59506799 CCTAGGCAACCAGTGTACTGTGG - Intergenic
1069708898 10:70476748-70476770 ACGTGCCAGGCACTGTGCTGTGG + Intergenic
1069727840 10:70592705-70592727 CCTGGACAGGGAGTGAGCTGGGG + Intergenic
1069800875 10:71080760-71080782 CCTTGGCTGTCAGTGAGCAGAGG - Intergenic
1070670912 10:78376621-78376643 CCCTGTCAGGCAGTGTGTTGGGG + Intergenic
1071984242 10:91034875-91034897 CAGTGGCAGGCAGTGTGCCCAGG + Intergenic
1074153234 10:110777114-110777136 AAGTGGGAGGCAGTGTGCTGAGG + Intronic
1075042992 10:119123463-119123485 CCAGGGCAGGCAGAGTCCTGGGG - Exonic
1075744267 10:124715613-124715635 CGTGGGCAGGCTCTGTGCTGAGG - Intronic
1076024529 10:127100798-127100820 CCTTGGCAGGAACAGAGCTGTGG + Intronic
1076692466 10:132230792-132230814 CCTGGGCAGGCAGCTTTCTGGGG - Intronic
1076746730 10:132518262-132518284 CCTGGACAGGCACTGTTCTGGGG + Intergenic
1076823968 10:132958045-132958067 GCTCCGCATGCAGTGTGCTGGGG + Intergenic
1076911131 10:133390342-133390364 CCTAGGCAGGAGGTTTGCTGAGG + Intronic
1076919056 10:133441910-133441932 GCGTGGCAGGCGGTGTGTTGGGG + Intergenic
1077443368 11:2578910-2578932 GCTGGGCAGTCACTGTGCTGAGG - Intronic
1078006264 11:7534797-7534819 CTCTGGCAGGCATTGTGCAGTGG + Intronic
1078483959 11:11704931-11704953 CTGTGGCAGGCTGTGTGCTACGG - Intergenic
1078915219 11:15772412-15772434 CCAGGGAAGGCAGTGTGGTGAGG - Intergenic
1080530342 11:33169158-33169180 CCTTGTCAAGCAGTTGGCTGGGG - Intergenic
1081729932 11:45364270-45364292 CCTTGGCAGGGACTGTTCTCAGG + Intergenic
1082088058 11:48066396-48066418 GCTCTGCAGGCAGTGGGCTGAGG + Intronic
1082764178 11:57153918-57153940 ACCTGGCAGACAGTGGGCTGAGG + Intergenic
1083148063 11:60773287-60773309 CTGTGGGAGGCAGCGTGCTGGGG + Intronic
1083491161 11:63015925-63015947 CACTGGCAGGGAGAGTGCTGTGG + Intergenic
1087935303 11:104026789-104026811 CCTTTGAAGGAAGTGTCCTGTGG + Intronic
1089195548 11:116692301-116692323 CCTGGAGAGGCAGAGTGCTGGGG - Intergenic
1089672187 11:120064200-120064222 CTATGGCAGGCAGGGAGCTGGGG - Intergenic
1090410883 11:126508853-126508875 CTATGACAGGCACTGTGCTGAGG - Intronic
1091845104 12:3649712-3649734 CCATGCCAGGCACTGTGTTGAGG - Intronic
1092119404 12:6033653-6033675 GAGAGGCAGGCAGTGTGCTGGGG - Intronic
1092284376 12:7120380-7120402 CCTGGGCAGGCAGGGTTCTCTGG + Intergenic
1092995069 12:13941884-13941906 CCTTAGCAGACACTGCGCTGCGG - Intronic
1093706063 12:22276096-22276118 CCTTGGTAGGCAGAGGCCTGAGG - Intronic
1094361791 12:29638775-29638797 CCCTGGCAGGGTGTGTGATGGGG - Intronic
1095348961 12:41187716-41187738 CCTAAGAAGGCAGTGTCCTGAGG + Intergenic
1095941887 12:47732812-47732834 CATAGGTGGGCAGTGTGCTGGGG - Intergenic
1096408353 12:51359783-51359805 CCTAGGCAGCCAGTGTGCTAAGG - Intronic
1096888951 12:54746956-54746978 GCTTGGTAGGCAGTGTACAGTGG + Intergenic
1097595336 12:61621538-61621560 CCTTGGCAGTCAGTGTGCCATGG - Intergenic
1098634002 12:72758180-72758202 CCTTGTCAGGCAGTGTGTTGTGG - Intergenic
1098807881 12:75043183-75043205 GCTTGGCAGGCAATGCTCTGAGG - Exonic
1101233385 12:102764670-102764692 ACTTGTCAGGCAGTATACTGAGG - Intergenic
1102307110 12:111813420-111813442 ATTTGGCAGGCAGTGTAATGAGG + Intergenic
1102762582 12:115401354-115401376 CTCTGGCAGGCACTGTGCTGGGG - Intergenic
1103837071 12:123830125-123830147 CCGTGCCAGGCAGTGGACTGGGG - Intronic
1103897187 12:124280358-124280380 GATTGGCAGTCAGTGTCCTGGGG + Intronic
1104902147 12:132195240-132195262 CCCCAGCAGGCAGGGTGCTGGGG + Intergenic
1105356307 13:19663192-19663214 CACTGCCAGGCACTGTGCTGGGG + Intronic
1105403880 13:20118454-20118476 CCTGGGCAGGCCGGGTGCTCAGG - Intergenic
1105849715 13:24323182-24323204 TCTTGGCAGGCACTGTGGTGGGG - Intergenic
1106628125 13:31441944-31441966 CCTTGGCAGGCACTGTGTGCAGG + Intergenic
1107003726 13:35583298-35583320 CCTTGGAAAGCATTTTGCTGAGG - Intronic
1107236377 13:38175745-38175767 ATTTGGCAGGCAGTGGGCTAGGG + Intergenic
1108643713 13:52406409-52406431 CCTGGTCCGGCTGTGTGCTGTGG - Intronic
1112567828 13:100566416-100566438 TTTTGCCAGGCAGAGTGCTGAGG - Intronic
1113415588 13:110126054-110126076 CCGTCTCAGGCACTGTGCTGGGG + Intergenic
1113476931 13:110590612-110590634 ACCTGCCAGGCATTGTGCTGAGG - Intergenic
1113692673 13:112322769-112322791 CCATGGCATGCCCTGTGCTGGGG + Intergenic
1114383693 14:22235140-22235162 CCTTGGAAGGCCGGGTGCGGTGG + Intergenic
1115159883 14:30381888-30381910 CCTTGGCAGGTAGTGTGTAAGGG + Intergenic
1115290829 14:31770301-31770323 GTTTGGCAGGCAGGGTGCTAGGG + Intronic
1115409798 14:33061147-33061169 CCTTGTCAGGGATTCTGCTGGGG + Intronic
1117060806 14:51961066-51961088 CAGTGGCAGGCAGTAAGCTGGGG + Intronic
1118401928 14:65387698-65387720 TCTTTCCAGGCAGTGAGCTGGGG + Intergenic
1118620571 14:67610774-67610796 CTTTGGTAGGCAGGGAGCTGGGG - Intergenic
1119401446 14:74365388-74365410 CCCTGCCAGGCAGAGAGCTGGGG + Intergenic
1122004166 14:98688386-98688408 CGTGGGCAGGCAGTGTTCTAGGG + Intergenic
1122087677 14:99318801-99318823 CCTTGGCTGGGAGTGGCCTGTGG - Intergenic
1122546861 14:102527901-102527923 CATTGCCAGGCAGTATCCTGGGG + Intergenic
1122586037 14:102807265-102807287 CCTGGGCAGGCAGGCTCCTGGGG - Intronic
1122628056 14:103094287-103094309 CCCTGACAGGCAGGGTGCAGGGG + Intergenic
1123056342 14:105572373-105572395 CCTTGGCAGGCAGTGGGTACAGG - Intergenic
1123057589 14:105579434-105579456 CCTTGGCAGGCAGTGGGTACAGG + Intergenic
1123080775 14:105692501-105692523 CCTTGGCAGGCAGTGGGTACAGG - Intergenic
1123081866 14:105699367-105699389 CCTTGGCAGGCAGTGGGTACAGG + Intergenic
1202915376 14_GL000194v1_random:165736-165758 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1125500065 15:40234102-40234124 CCTTGGCAGGGAGGGTACAGAGG - Intergenic
1127693961 15:61425825-61425847 TCATGGCAGGAAGTGTGCTAGGG - Intergenic
1128183681 15:65626122-65626144 CTCTGCCAGGCACTGTGCTGGGG + Intronic
1128290759 15:66476705-66476727 CCATGGCAGGCTCTGTGCAGGGG + Intronic
1128451647 15:67809230-67809252 CCTTGCTGGGCAGTGTGCTTAGG + Intergenic
1128741692 15:70088271-70088293 CCTTTGCAGGCAGCAAGCTGTGG - Intronic
1129161038 15:73748075-73748097 GCTTGGCATGCAGTGGGCTGGGG - Intronic
1129291338 15:74570222-74570244 CCTTGGCAGGATGGGGGCTGGGG - Intronic
1129542582 15:76363033-76363055 CTGTGGCAGGCACAGTGCTGGGG - Intronic
1129776078 15:78237295-78237317 CCAGGGCAGGCAGTGAACTGAGG + Intronic
1130678916 15:85979447-85979469 CCCAGGCAGGGAGTGAGCTGGGG - Intergenic
1130925060 15:88379160-88379182 ACTTGCCAGGCACTGTGCTATGG - Intergenic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1131794501 15:96001051-96001073 CTGTGCCAGGCACTGTGCTGGGG + Intergenic
1132409575 15:101566714-101566736 CCTCCGGAGGCACTGTGCTGTGG - Intergenic
1132531250 16:450956-450978 CGATGGCAGGCAGAGCGCTGCGG - Intronic
1132599275 16:766817-766839 CCTTGCCGGGCAGAGTTCTGGGG - Intronic
1132630652 16:915678-915700 GCTGGCCAGGCAGAGTGCTGGGG + Intronic
1132729699 16:1355416-1355438 CCTTGGCAGACACTCTTCTGCGG - Intronic
1132931452 16:2461048-2461070 CCTTGGCAGGCACCGTGGTCTGG - Exonic
1133617769 16:7494487-7494509 ACTTGGATGGCAGTGTGCAGGGG - Intronic
1135862204 16:26066943-26066965 CATTGGCAGGGTCTGTGCTGTGG + Intronic
1136023791 16:27456903-27456925 CCCTGGAAGGCGGTGTGATGGGG + Intergenic
1136630331 16:31486104-31486126 CCTGGGCAGGAGGTGGGCTGGGG + Intronic
1137808010 16:51325781-51325803 CCTTTGCATGCAGTGGGCTTTGG - Intergenic
1137821761 16:51452805-51452827 CCTTCGCAGTGAGTGAGCTGGGG - Intergenic
1138064226 16:53923886-53923908 CAGTGGCAGGCAGGCTGCTGTGG + Intronic
1138505691 16:57477180-57477202 CCTTGGCAGGCAGGGTCCCAGGG + Intronic
1138597376 16:58036215-58036237 CCATGGGAGGCAGTGAGCAGAGG - Intronic
1138649203 16:58448980-58449002 CCTTGGCTCTCTGTGTGCTGAGG - Intergenic
1139420945 16:66849200-66849222 CCTTGACACCCAGTGAGCTGGGG - Intronic
1139513839 16:67442043-67442065 AAGTGGCAGGCAGTTTGCTGTGG - Intronic
1140524826 16:75613902-75613924 ATTTGGCAGGCAGGGTGCGGTGG + Intronic
1141251837 16:82366097-82366119 CCTGGGCAGGGAGAGTGGTGTGG - Intergenic
1141529171 16:84634321-84634343 CCGAAGCAGGGAGTGTGCTGGGG + Intergenic
1141795264 16:86268700-86268722 CCTTGAAAGGCTGTTTGCTGGGG - Intergenic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142328232 16:89432410-89432432 CCGTGGCATGCACTGTGTTGAGG + Intronic
1142599691 17:1047530-1047552 CCTTGGCATGCTGAGTGCTGGGG + Intronic
1142699684 17:1651378-1651400 CCTTGGGAGGAAGTATGGTGGGG - Intronic
1143128374 17:4659666-4659688 CCTTGGGAGGCAGAGGCCTGAGG - Intergenic
1144016069 17:11197525-11197547 GCTTGGCAGGCAGGGAGCTAGGG - Intergenic
1144454679 17:15409000-15409022 CCTGGGTACTCAGTGTGCTGGGG - Intergenic
1144662937 17:17083035-17083057 CTGTGGCAGGCATGGTGCTGAGG + Intronic
1145273561 17:21417250-21417272 CCTGGGCAAGCAGGGTGCTCTGG + Exonic
1145302179 17:21648404-21648426 GCTTTGGAGGCAGTGTGGTGGGG + Intergenic
1145311758 17:21704692-21704714 CCTGGGCAAGCAGGGTGCTCTGG + Intergenic
1145348134 17:22054912-22054934 GCTTTGGAGGCAGTGTGGTGGGG - Intergenic
1145889979 17:28407478-28407500 ACGTGCCAGGCACTGTGCTGGGG + Intergenic
1145902386 17:28497217-28497239 GCTTGGCAGGCACTGGGCTGTGG - Exonic
1146798532 17:35800132-35800154 CCTGGGCAGGCAATGTGCCCAGG - Intronic
1148484727 17:47983237-47983259 CCTTGGTAAGCAGTGTGGTTAGG + Intergenic
1148676848 17:49450791-49450813 CCCTGGCACACAGCGTGCTGTGG + Intronic
1149249757 17:54754777-54754799 CCTGGCCAGGCAGTGAGCGGGGG - Intergenic
1152204118 17:78964952-78964974 CACTGGCAGGCAGGGTGCTGTGG + Intergenic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1152870710 17:82751760-82751782 CCTGAGCAGGCGGTGTGCGGGGG - Intergenic
1154000157 18:10475874-10475896 TCTTGGCCTGCAGTGTGCAGCGG + Intronic
1154170599 18:12047818-12047840 CGGTGGCAGGCAGGGTGGTGGGG - Intergenic
1154437296 18:14356931-14356953 ACTTGGCAGGGCGTGTGGTGGGG + Intergenic
1156789081 18:40950035-40950057 CATTGGGAGGCAGTTTGCTTAGG - Intergenic
1157085341 18:44574738-44574760 TCTTTGCAGGCAGGGTGCGGTGG - Intergenic
1157298862 18:46465402-46465424 CCATGGCAGGAAGTGGGCAGAGG - Intergenic
1157814093 18:50718503-50718525 TCTTGGCAGGCTGGGTGCAGTGG - Intronic
1158224020 18:55182025-55182047 CCCTGGGTGGCACTGTGCTGGGG - Intergenic
1158428977 18:57366561-57366583 CCTTTGCAGGCACTGTTTTGTGG - Exonic
1158562003 18:58522365-58522387 CCTTGCCTGGTGGTGTGCTGGGG - Intronic
1158585273 18:58727584-58727606 CTTTGGCAGGCTGGGTGCAGTGG - Intronic
1161512291 19:4678534-4678556 CCTGGGAAGGCAGTGGGCTCGGG + Intronic
1161826625 19:6571673-6571695 ACTTTGCAGGCAGGGTGCAGTGG + Intergenic
1162143130 19:8596492-8596514 CCTATGAAGGCAGTGGGCTGGGG - Intronic
1162150582 19:8642596-8642618 CATTAGCAGGCTGTTTGCTGGGG + Intergenic
1162248911 19:9426103-9426125 CAATGGAAGGCAGTGTCCTGGGG - Intronic
1163333544 19:16657111-16657133 GCGTGCCAGGCAGTGTGCTAAGG - Intronic
1163500809 19:17675038-17675060 CCTTTGCAGGCTGGGTGCAGTGG + Intronic
1163520022 19:17786618-17786640 CCGAGGCAGGCGGTGAGCTGTGG + Exonic
1163889830 19:20000910-20000932 CCTTGGCCAGCACTGGGCTGTGG + Intronic
1163933887 19:20424260-20424282 CCTTGGCAGCGAGTGTGCCCCGG - Intergenic
1165152467 19:33769145-33769167 CCTCGGAGGGCAGTGGGCTGTGG - Intronic
1166116082 19:40655423-40655445 CCTTGGCACACAGTGTTATGTGG + Intergenic
1166756632 19:45196475-45196497 CCTTGGCAGGCTCAGTGCTGTGG - Intronic
1167287252 19:48605283-48605305 CCTAGGAAGGCCGTGTGCAGTGG + Intronic
1167385637 19:49161572-49161594 CTTTGGCAGGCAGAGTGAGGTGG - Intronic
1168643960 19:58047890-58047912 CGTGGGCAGGCAGTGTCCTGTGG + Intronic
925171352 2:1752005-1752027 CCTTGGCACGCTGTGTGCGGAGG + Intergenic
925574806 2:5349619-5349641 CCTGGGGAGGGTGTGTGCTGGGG + Intergenic
925646740 2:6044207-6044229 CCTCGGGCTGCAGTGTGCTGGGG - Intergenic
925919169 2:8627527-8627549 CCCTTGCAGGCAGGGTTCTGAGG - Intergenic
927636669 2:24821703-24821725 CCTTCCCTGGCAGTGTTCTGGGG + Exonic
927694172 2:25229267-25229289 CCTTACCAGGCCCTGTGCTGGGG - Exonic
927865060 2:26582950-26582972 CCATGTCAGGCAGTGAGGTGGGG + Intronic
932400348 2:71476262-71476284 CCTTGGCAGGCTGGGTGTGGTGG + Intronic
932584802 2:73020937-73020959 CCGTGGCAGCCAGTGAGCAGTGG + Intronic
934763222 2:96867574-96867596 CCTGGGCAGGCAGTCTGGGGTGG + Intronic
934835846 2:97589444-97589466 CCTTTGCAGGCTGAGGGCTGCGG - Intronic
936927582 2:117753399-117753421 GCTTGGGAGGCAGTTTGCTGTGG - Intergenic
937253763 2:120540669-120540691 CCTAGGCAGGCAGTGCACCGGGG + Intergenic
937301786 2:120847210-120847232 GCTCAGCAGGCACTGTGCTGAGG + Intronic
937331577 2:121033806-121033828 TCTTGGCTGGCAGTGTGCTCTGG - Intergenic
938080721 2:128368657-128368679 CCCTGCCAGGCAGGCTGCTGGGG - Intergenic
938195882 2:129327458-129327480 TCTCGGCAGCCACTGTGCTGGGG - Intergenic
938577023 2:132614524-132614546 CCTTGGCTGGCTGGGTGCGGTGG - Intronic
938976797 2:136486458-136486480 CCTTAGCAGGCCGGGTGCGGTGG + Intergenic
940362616 2:152812865-152812887 CCTGGGCAGCAGGTGTGCTGTGG + Intergenic
940684387 2:156827728-156827750 CATAGGCAGCAAGTGTGCTGTGG - Intergenic
941124745 2:161571371-161571393 CCCAGGCAGGCAGTGTGGTCAGG + Intronic
943585393 2:189733123-189733145 CCTTGGCATGCATTGTCCTAGGG + Exonic
944040799 2:195351904-195351926 CCATGGCAGGCCGGGTGCAGTGG + Intergenic
944683808 2:202100190-202100212 GAAAGGCAGGCAGTGTGCTGGGG - Intronic
946096231 2:217276675-217276697 CCTTGGCTGGGATTGTCCTGAGG + Intergenic
946423292 2:219577212-219577234 CCTATTCAGGCAGTGGGCTGGGG + Intergenic
946555997 2:220857974-220857996 CCTGGGCAGGAAGTGGGCTATGG + Intergenic
947148840 2:227093604-227093626 GTTTGGCAGGCAGGGGGCTGGGG - Intronic
947449467 2:230194018-230194040 CCTAGGGAGGCAGTGGGGTGGGG + Intronic
948170631 2:235898969-235898991 CCTTGGCAGGCATTATGTTTAGG + Intronic
948462967 2:238139088-238139110 CCTGGGCAGGCACTGGGGTGAGG + Intronic
948494725 2:238340027-238340049 CCTTGGGTGGCAGTGTGCGGTGG + Intronic
948529620 2:238596038-238596060 CCTTTCCTGGCTGTGTGCTGTGG - Intergenic
948628721 2:239287046-239287068 CCTGGGCAGGGAATGTCCTGGGG + Intronic
1168813974 20:724061-724083 CCTTGGAAGGCAGAGTGCTCTGG + Intergenic
1168832220 20:852387-852409 AGTTGGCAGGCTGTTTGCTGGGG + Intronic
1169616772 20:7456936-7456958 TCTGGGCAGGTAGTGTGCAGAGG - Intergenic
1170580395 20:17694907-17694929 CCTCTGCAGGCAGGGTGCGGTGG - Intronic
1170703740 20:18727075-18727097 CCTTGGCAGGTGCTGTGGTGAGG + Intronic
1170947391 20:20903557-20903579 CCTTGGTGGGCATTGTGCTTTGG + Intergenic
1171227310 20:23452374-23452396 CCTTGGGATGTAATGTGCTGAGG + Intronic
1171965074 20:31523751-31523773 CTTTTGCCAGCAGTGTGCTGTGG - Intronic
1172789167 20:37490679-37490701 CCTTGGCAGGAACTGTTTTGGGG - Intergenic
1173059736 20:39650197-39650219 CATGTGCAGGCAATGTGCTGGGG + Intergenic
1173895494 20:46547647-46547669 CCTTGGCAGGGAGAGTTCGGTGG + Intronic
1174039685 20:47690098-47690120 CTCTGGCAGGCAGAGTGCTGAGG + Intronic
1174401319 20:50277554-50277576 CCTGGACAGGCGCTGTGCTGGGG - Intergenic
1175421101 20:58834306-58834328 CCATGCCAGCCAGTGAGCTGTGG - Intergenic
1175974849 20:62705655-62705677 CTGGGGCAGCCAGTGTGCTGGGG - Intergenic
1176634726 21:9180380-9180402 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1177886793 21:26757023-26757045 CTTTTGTAGTCAGTGTGCTGTGG + Intergenic
1177926442 21:27221925-27221947 CCTTGTCCGGCCGGGTGCTGTGG + Intergenic
1178137957 21:29649504-29649526 CCTGGGCAGGAAGTGTGATAAGG - Intronic
1178922020 21:36744997-36745019 CGCTGGCTGGCAGTGTGCTCAGG - Exonic
1179514568 21:41897802-41897824 CCATGGCAGGCTGTGGGCTTTGG + Intronic
1180738015 22:18033239-18033261 CCCAGGCAGGCAGGGGGCTGTGG + Intergenic
1181037790 22:20178257-20178279 CCCTCACAGGCAGAGTGCTGTGG - Intergenic
1181303247 22:21897369-21897391 CATTGTAAGGCAGTGTGCGGTGG - Intergenic
1181368032 22:22394847-22394869 CCCAGGGAGGCTGTGTGCTGTGG - Intergenic
1181475809 22:23167204-23167226 CCCTGGGTGGCAGTGTGCTGGGG - Intergenic
1181857974 22:25796295-25796317 CTTTGGCAGGCTGGGTGCAGTGG + Intronic
1183469289 22:37997107-37997129 CCTGGGGAGGGTGTGTGCTGTGG + Intronic
1183785480 22:40026778-40026800 CCCTGGCTGGCAGTGTGGTCTGG + Intronic
1184098463 22:42329265-42329287 CCTTGGCAGCCTGTGTGCTGGGG - Intronic
1185127010 22:49016920-49016942 CCTTCGCAGGACGTGTGATGGGG + Intergenic
1185207784 22:49550031-49550053 CCACGGCAGGGAGTGAGCTGAGG + Intronic
949917460 3:8975797-8975819 CCTTGGCATGGGGGGTGCTGTGG - Intergenic
950542132 3:13618996-13619018 CCTTTGCAGGTATTGGGCTGCGG - Exonic
950626636 3:14252327-14252349 CCTTTGGGGGCAGTGTGCTGTGG + Intergenic
953329135 3:42037457-42037479 CAATGGCAGGCAGGGTACTGGGG + Intronic
953891776 3:46756405-46756427 CCTTGGAAGGCAGTTTTCTCAGG - Exonic
954089372 3:48272308-48272330 CCTTGGCTGGCAGAGAGGTGTGG - Intronic
954543687 3:51414982-51415004 CTTTGGGAGGCAGTATTCTGTGG - Intronic
955348288 3:58176845-58176867 CCTAGGAAAGCAGTGTGGTGTGG + Intergenic
955378070 3:58414658-58414680 CTCTGCCAGGCATTGTGCTGGGG - Intronic
958958360 3:100485962-100485984 CCTTGGCAGGCAGGGATCTGTGG + Intergenic
960341819 3:116484205-116484227 AGTGGGCAGGCTGTGTGCTGGGG + Intronic
961557521 3:127706809-127706831 CCGTGGAAGGCTGTGTCCTGGGG + Intronic
961635503 3:128330354-128330376 ATGTGGCAGGCACTGTGCTGAGG + Intronic
961723560 3:128911343-128911365 CCTTGGCAGGCCCGGTGCGGTGG - Intronic
962844762 3:139264386-139264408 TTGTGGCAGGCATTGTGCTGGGG + Intronic
963724709 3:148907466-148907488 GCTTGGAAGGCATTGTGCTTGGG - Intergenic
965754902 3:172015813-172015835 CCGTGTCAAGCACTGTGCTGGGG - Intergenic
966971848 3:185051568-185051590 CCTGGGCTGGCCCTGTGCTGAGG - Intronic
967219644 3:187237726-187237748 CCTTCCCAGGCAGGGTGCTTGGG + Intronic
967445073 3:189555829-189555851 CAGTGGCAGGCAGTCTGGTGTGG - Intergenic
967985836 3:195094773-195094795 CCTTCGCAGGCTGTGTGGAGAGG - Intronic
968143675 3:196279440-196279462 ACTTAGCAGGCAGGGTGTTGGGG - Intronic
968226574 3:196976105-196976127 CCCTGGCAGGCAGGGGCCTGAGG - Intergenic
968282691 3:197489288-197489310 CCTGGGCAGGAACTGTGCTGGGG - Intergenic
968536294 4:1132186-1132208 CATGGGCAGGCAGTGTTCTCAGG - Intergenic
968808624 4:2790250-2790272 CCCTGGCCGGCAGGGAGCTGGGG - Intergenic
968941031 4:3637846-3637868 TCTCTGCAGGCAGTGAGCTGGGG - Intergenic
969086974 4:4663949-4663971 CATTGGCTGGCAGAGGGCTGGGG + Intergenic
970299740 4:14668519-14668541 CCTTGGCAGACAGTATAATGTGG + Intergenic
972408028 4:38764990-38765012 CCTAGGCAGGCAGATTGCTTGGG + Intergenic
973044454 4:45518974-45518996 CCCTGGCAGGGAGTGTGCCAGGG + Intergenic
973177763 4:47228989-47229011 TATTGCCAGGCACTGTGCTGGGG + Intronic
975242854 4:72082001-72082023 CCTTGTCAGGGAGTGGGATGAGG + Intronic
975712315 4:77173109-77173131 CCTTGGCAGGCAGCCTTCTGTGG + Intronic
978338093 4:107691272-107691294 ACATGCCAGGCACTGTGCTGAGG + Intronic
978854125 4:113373761-113373783 GCTGGGCAAGCAGTATGCTGTGG + Intronic
980716541 4:136636820-136636842 CCTTTGCAGGGAGTGTGATGGGG - Intergenic
983056861 4:163107754-163107776 CCTTGGCAAGCAGGGTGGAGGGG - Intergenic
983850089 4:172569826-172569848 CCTCGGCTCCCAGTGTGCTGAGG - Intronic
983872096 4:172834523-172834545 CCTTGGCAGGCAGTTCTCTCGGG - Intronic
984041800 4:174744239-174744261 CCTGAGCAGCCAGTGTGGTGTGG - Intronic
984535201 4:180966182-180966204 CTTTGGCATGAAGTGTGGTGTGG + Intergenic
984989713 4:185368393-185368415 CCATGGCAGGCAGTGTGTTATGG - Intronic
985100349 4:186452288-186452310 CTTTGGCAGGCAGGGAGCTAGGG + Intronic
985649746 5:1101942-1101964 GCTTGGCAGGGAGGGAGCTGGGG - Intronic
986438665 5:7759461-7759483 CCTTGGCTGGCAGTCCCCTGTGG + Intronic
987502841 5:18735474-18735496 CCTGGCCAGGCAGGGTGCGGTGG + Intergenic
987734982 5:21829060-21829082 CCGAGGCAGGCAGTCAGCTGAGG + Intronic
988609128 5:32709320-32709342 GGTTGCCAGGCACTGTGCTGGGG - Intronic
988707096 5:33737185-33737207 TGTTGGGAAGCAGTGTGCTGTGG + Intronic
988984168 5:36600587-36600609 CCTGGGGAGGCAGTGGGATGAGG + Intergenic
989470502 5:41811876-41811898 CCTAGGCATGAAGTGTGGTGAGG + Intronic
989578081 5:43007384-43007406 CCTAGGCAGGCAGCGTGGGGTGG + Intergenic
989617999 5:43356613-43356635 ACTTGGCAGGTAGTGGGGTGGGG - Intergenic
990640624 5:57779986-57780008 CCTTTGAAGACAGTGTGCTGAGG - Intergenic
991596873 5:68315418-68315440 CCTTGTAAGGCAGTATGGTGTGG - Intergenic
992000266 5:72429509-72429531 ACATGGCAGGCACTGTGTTGGGG - Intergenic
992638362 5:78747169-78747191 CCTTGGCAGCCCATCTGCTGAGG + Intronic
993028432 5:82673539-82673561 CCTTGGCAGGCATACGGCTGGGG + Intergenic
993307105 5:86287483-86287505 ACTGGGCAGGCAATGAGCTGGGG - Intergenic
994094132 5:95833346-95833368 CCTTTGCACGCAGTCTGGTGGGG - Intergenic
994247897 5:97501438-97501460 ACATGGCAGACAGTGTGCTCAGG + Intergenic
995547831 5:113250485-113250507 TGTTGGGAGGCAGCGTGCTGTGG - Intronic
996471551 5:123867122-123867144 ACTTAGCAGTCAGTCTGCTGGGG + Intergenic
996628521 5:125599968-125599990 TCTTGGCAGGCAGTGGGGTAAGG - Intergenic
997525421 5:134549910-134549932 CCTTGCCAGGTCCTGTGCTGGGG + Intronic
997803286 5:136888501-136888523 CCTTGCCAGGCAGAGGGATGAGG - Intergenic
997979981 5:138463069-138463091 GCTTGGCTGGCTGGGTGCTGTGG + Intergenic
997999070 5:138609930-138609952 CCTTGGGAGGCAGTGCCCAGTGG - Intergenic
998409243 5:141896603-141896625 CCTTGGCGGGCAGGGCGCGGCGG + Intergenic
998792205 5:145777775-145777797 CCTTGGTTTGCAGTGTGCTTTGG - Intronic
998875137 5:146591416-146591438 CCTTGTCAGGCAGGGCGCTGAGG + Intronic
999078951 5:148825781-148825803 ACTTGACAGCGAGTGTGCTGAGG + Exonic
999509114 5:152229234-152229256 GATTGAGAGGCAGTGTGCTGTGG + Intergenic
999714999 5:154353432-154353454 CCTTGGAAGGTGGGGTGCTGAGG - Intronic
1000132932 5:158317608-158317630 CCATGGGAGGGAGTGTGATGGGG - Intergenic
1001102514 5:168825788-168825810 CCTTGGCAGGGAGCTTCCTGGGG + Intronic
1001436985 5:171706964-171706986 CCTTGGCAGCCAGTGTGCACTGG + Intergenic
1001855066 5:175003813-175003835 CCTCAGCAGGCAGTGAGCTGTGG + Intergenic
1001881312 5:175246622-175246644 TCTTGAGAGGCAGTGTGATGTGG - Intergenic
1001949201 5:175804340-175804362 CCAAGGCAGGCAGTGTTCTCTGG - Intronic
1002029098 5:176415336-176415358 ACTTGGTAGGCAGTGTGGTCAGG + Intronic
1002304251 5:178274011-178274033 CCCTGCAGGGCAGTGTGCTGTGG - Intronic
1003308348 6:4947930-4947952 CCACAGCAGGCAGTTTGCTGGGG + Intronic
1003618005 6:7672883-7672905 CCATGGTGAGCAGTGTGCTGGGG - Intergenic
1003637716 6:7848513-7848535 CTTTGACAGGCAGGGAGCTGGGG - Intronic
1004275629 6:14233046-14233068 CCATGGCAGGGAGGGAGCTGGGG - Intergenic
1005455810 6:26018650-26018672 CCCTGACAGGCATTCTGCTGGGG + Intergenic
1005521230 6:26602290-26602312 CATTTGCAGGCAATGTGCTGGGG - Intergenic
1005637907 6:27768666-27768688 GTTTGGCTGGCAGTGTTCTGGGG + Intergenic
1006456752 6:34136388-34136410 TCATGACAGGCTGTGTGCTGGGG + Intronic
1007010669 6:38414587-38414609 CAATGGCAGGCAGCATGCTGAGG - Intronic
1007228450 6:40331071-40331093 ACTTGCAGGGCAGTGTGCTGTGG - Intergenic
1007688168 6:43679827-43679849 CCTTGGGAGGCAGGTTGCAGTGG + Intronic
1011034802 6:82961564-82961586 CCTCAGCAGTCAGTGTGGTGTGG - Intronic
1011761663 6:90573882-90573904 CCTGGGCACTCAGTGTTCTGTGG + Intronic
1013454962 6:110322292-110322314 GCTTTGCAGGCAGTGTGCTGAGG - Intronic
1015616863 6:135086259-135086281 CTTTGGCAAGAGGTGTGCTGGGG - Intronic
1017512835 6:155129769-155129791 CCTCTGCAGGCACTTTGCTGGGG - Exonic
1017825217 6:158076729-158076751 CCTGGACAGACAGGGTGCTGTGG + Exonic
1018152953 6:160957038-160957060 CCATGGCAGGAAGAGAGCTGGGG + Intergenic
1018845219 6:167551313-167551335 CTTAAGCAGGCAGTATGCTGAGG - Intergenic
1019256765 7:57349-57371 CCATGGCAGGCTGGGTGCTGGGG + Intergenic
1019511753 7:1421197-1421219 CCTCGGAAGGCAGGGTGCAGAGG + Intergenic
1019746082 7:2701046-2701068 CCATCCCAGGCACTGTGCTGCGG + Intronic
1020144452 7:5632009-5632031 CCAAGGTGGGCAGTGTGCTGAGG + Intronic
1020472503 7:8555031-8555053 CCTTGGAAGGCAGTGTGGTTTGG + Intronic
1022997125 7:35768554-35768576 CCTTGGCAGGCAGGGCACGGCGG + Intergenic
1023632689 7:42179597-42179619 CCTAGGAAGGCAGTGAGCAGGGG + Intronic
1024264602 7:47597093-47597115 CCCTTGCAGGGAGTGTGATGGGG - Intergenic
1024294258 7:47830233-47830255 CCGTGGCAGGAAGCCTGCTGTGG + Intronic
1024565624 7:50677477-50677499 CTTTGGCAGGCAGAGTTCTCTGG - Intronic
1025279255 7:57614961-57614983 GCTTTGGAGGCAGTGTGGTGGGG + Intergenic
1025305476 7:57850539-57850561 GCTTTGGAGGCAGTGTGGTGGGG - Intergenic
1026846544 7:73701982-73702004 CCTTGGCAGGCAGTGTGCTGGGG - Intronic
1028968264 7:96827379-96827401 CCTTGGGATGCTGAGTGCTGTGG - Intergenic
1032541296 7:132705304-132705326 TCTTGGCAGGCAGAGTCTTGAGG + Intronic
1033824319 7:145170915-145170937 ACTGGGCAGCCAGAGTGCTGTGG + Intergenic
1034030464 7:147757140-147757162 CCTTGGCAGCCAGTTTGCAGGGG - Intronic
1034216937 7:149415070-149415092 CTTTGGAAATCAGTGTGCTGTGG + Intergenic
1034641319 7:152605880-152605902 CATTGGCAGGCTGGGTGCAGTGG + Intergenic
1035217096 7:157376018-157376040 CCGCGGCTGGGAGTGTGCTGAGG + Intronic
1035761814 8:2074036-2074058 TTATGTCAGGCAGTGTGCTGGGG + Intronic
1035860962 8:3027257-3027279 CCAGGGAATGCAGTGTGCTGGGG - Intronic
1037319683 8:17631155-17631177 CCTTGGCAAGCAGTTCTCTGAGG + Intronic
1037700008 8:21265214-21265236 CCCTGGCTGGCAGTGTGCCCCGG - Intergenic
1037839810 8:22236373-22236395 CCTTGCCAAGCAGTGCGCAGTGG - Intergenic
1038059746 8:23899753-23899775 CTCTGCCATGCAGTGTGCTGGGG + Intergenic
1038970979 8:32635219-32635241 CTGTGACAGGCATTGTGCTGGGG - Intronic
1039437233 8:37568038-37568060 GCATGCCAGGCACTGTGCTGGGG + Intergenic
1041212447 8:55566238-55566260 CTTTGGCAGGCAGGGGGCTAAGG - Intergenic
1042130002 8:65579000-65579022 CCTGGGCAGGCAGTGTGGTGGGG + Intergenic
1046908327 8:119598799-119598821 CCATGGAAGGGAGTGTGCTCTGG + Intronic
1047516014 8:125555465-125555487 GCAGGCCAGGCAGTGTGCTGGGG + Intergenic
1049380667 8:142314198-142314220 CCTTGTCAGGCACTGTGCCAGGG + Intronic
1049428179 8:142546757-142546779 CCTTCGCAGGCAGGGTTGTGTGG - Intergenic
1050168942 9:2795586-2795608 CCTTGGCAGGCTGGGTGCAGTGG + Intronic
1050346213 9:4690805-4690827 CCTGGGGATCCAGTGTGCTGTGG - Intronic
1050533677 9:6612359-6612381 CTTTGACAGGGAGTGTGGTGGGG - Intronic
1052707935 9:32015893-32015915 CCTTGGCAGGCATAGTACTCAGG - Intergenic
1052945517 9:34165273-34165295 CCTAGGCAGACAGAGTGCAGTGG + Intergenic
1054708165 9:68483946-68483968 CATTGGCCAGCAGTTTGCTGTGG + Exonic
1056540275 9:87565058-87565080 TGCTGGCAGGCAGTGTGCTGTGG + Intronic
1056881467 9:90397764-90397786 CATTGGCAGGCCGGGTGCAGTGG + Intergenic
1057276199 9:93677081-93677103 CCTTGGGTGGCAGGGTGCTGTGG + Intronic
1057731575 9:97613518-97613540 CCTTAAGAGGCAGTGTTCTGGGG + Intronic
1057890099 9:98863435-98863457 CATTGGCAGGCTGTGGGGTGGGG + Intergenic
1059833932 9:118129034-118129056 CCTGGTCAGCCAGGGTGCTGTGG - Intergenic
1059954456 9:119501163-119501185 CTTTGCCAGGCACTGTGCTATGG - Intronic
1060148136 9:121268962-121268984 CCTTGGAAGGCTGGGGGCTGGGG + Intronic
1060561513 9:124548903-124548925 CCATGGCAGGAAGTGGGATGGGG - Intronic
1060677925 9:125533114-125533136 CTTTGGCAGGAAGTGAGGTGGGG + Intronic
1060748322 9:126152236-126152258 CTTTGCCAAGCAGTGTGCAGGGG - Intergenic
1061048895 9:128182586-128182608 CCGGGGCAGGTAGTGTGCAGAGG - Intronic
1061192095 9:129087970-129087992 CTGTGCCAGGCTGTGTGCTGGGG + Intronic
1062149134 9:135008543-135008565 CCTTGGCTGGCAGTGTGACCAGG + Intergenic
1062218798 9:135403442-135403464 CCGTGGCAGGCAGTGGGGCGTGG - Intergenic
1062219606 9:135408009-135408031 TCATGGCAGGGAGTGGGCTGGGG + Intergenic
1062357800 9:136173216-136173238 CCTGGGCTGACAGTGAGCTGGGG - Intergenic
1062543253 9:137050826-137050848 CCTGGACAGCCACTGTGCTGTGG - Intronic
1062745924 9:138211992-138212014 CCCTGGCAGGGAGGGTGCAGGGG + Intergenic
1203757507 Un_GL000218v1:147689-147711 CAGTGGCAGGCAGAGTTCTGGGG - Intergenic
1189229825 X:39443478-39443500 CATTGGAAGGTAGTGAGCTGTGG + Intergenic
1189320074 X:40082544-40082566 CATTCCCAGCCAGTGTGCTGGGG + Intronic
1189958420 X:46301281-46301303 CTTTGGCAGGCAGGGGGCTGAGG + Intergenic
1190223496 X:48528406-48528428 CCTTGGCATCCAGCGTGCTCTGG - Exonic
1190700008 X:52980636-52980658 CCATGGCTGGCAGTCTGCAGAGG + Intronic
1191634719 X:63363296-63363318 ACTTGGCCTGCAGTGTACTGGGG - Intergenic
1194872332 X:99147318-99147340 CCTGGGCAGACAGTGTGGTGTGG - Intergenic
1198299134 X:135317517-135317539 CCTGGGCAGTCAGTGTGGTGAGG + Intronic
1200279016 X:154761339-154761361 CCTGGGCATGCAGTGGGCTGAGG - Intergenic
1200383562 X:155865554-155865576 CACTGGCAGTCACTGTGCTGCGG - Intergenic
1201509992 Y:14748518-14748540 TCTTGGCATGCAGTGTTCAGAGG - Intronic
1201685241 Y:16694122-16694144 CTTTGGCATGCTGAGTGCTGTGG - Intergenic