ID: 1026850206

View in Genome Browser
Species Human (GRCh38)
Location 7:73719197-73719219
Sequence CTGTCTACACCGAGGGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 95}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026850196_1026850206 -4 Left 1026850196 7:73719178-73719200 CCCACCGCGGTCCCCTCGTCTGT 0: 2
1: 0
2: 0
3: 6
4: 63
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95
1026850191_1026850206 23 Left 1026850191 7:73719151-73719173 CCCTCGTCTGTCTACACCAAGGA 0: 1
1: 0
2: 1
3: 5
4: 96
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95
1026850197_1026850206 -5 Left 1026850197 7:73719179-73719201 CCACCGCGGTCCCCTCGTCTGTC 0: 2
1: 0
2: 0
3: 15
4: 82
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95
1026850192_1026850206 22 Left 1026850192 7:73719152-73719174 CCTCGTCTGTCTACACCAAGGAG 0: 1
1: 0
2: 1
3: 5
4: 87
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95
1026850198_1026850206 -8 Left 1026850198 7:73719182-73719204 CCGCGGTCCCCTCGTCTGTCTAC 0: 2
1: 0
2: 0
3: 8
4: 102
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95
1026850195_1026850206 7 Left 1026850195 7:73719167-73719189 CCAAGGAGGTTCCCACCGCGGTC 0: 1
1: 0
2: 0
3: 6
4: 80
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95
1026850189_1026850206 24 Left 1026850189 7:73719150-73719172 CCCCTCGTCTGTCTACACCAAGG 0: 1
1: 1
2: 0
3: 7
4: 96
Right 1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG 0: 1
1: 0
2: 1
3: 8
4: 95

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026850206 Original CRISPR CTGTCTACACCGAGGGGGCA CGG Intronic
900322539 1:2092263-2092285 CTCTTCACACAGAGGGGGCAGGG - Intronic
900700642 1:4046837-4046859 TTGTCTACACCAAAAGGGCAAGG + Intergenic
901195693 1:7438659-7438681 CTGTCTCCTCCGAGGGGCAAGGG + Intronic
902043470 1:13509084-13509106 CTGTCTCCACCCAGGAGACAGGG + Intronic
904856375 1:33501074-33501096 CAGACTTCACCCAGGGGGCAAGG + Intergenic
905462951 1:38133412-38133434 CTGTCTGCAGCCAGGGGGAAAGG - Intergenic
905933500 1:41806305-41806327 CTGACTACACAGCGTGGGCATGG + Intronic
917788924 1:178487176-178487198 CTGTCTGCACTGGGTGGGCAAGG - Intergenic
1066663387 10:37758483-37758505 CTCTGTCCACTGAGGGGGCATGG - Intergenic
1066784141 10:38983509-38983531 CTTTCTACACCTAGAGAGCATGG + Intergenic
1074674757 10:115835804-115835826 CTGTCCTCAGCGAGGGGGCATGG - Intronic
1076410596 10:130246271-130246293 ATGTCTCCACCGAGTGGGCTTGG + Intergenic
1084031992 11:66486687-66486709 CTGACTCCCCCGAGGGGACAGGG + Intronic
1097167822 12:57094940-57094962 CTGCCCAGAGCGAGGGGGCAAGG + Exonic
1097907799 12:64938378-64938400 CTGTCTCCACCCAGTGGGCCAGG + Intergenic
1103081402 12:118026866-118026888 CTGTGTAGACAGAGGGGGAAAGG - Intronic
1104280505 12:127372294-127372316 CTGACTAGACCTAGGGGGCATGG - Intergenic
1109309601 13:60676996-60677018 CTGTCTACTGCAGGGGGGCAGGG + Intergenic
1113648342 13:112014832-112014854 CTGTCAACACTGAGGGTGCCAGG - Intergenic
1113652786 13:112048054-112048076 CTGTCTACTCCATGAGGGCAGGG - Intergenic
1113684856 13:112276008-112276030 CTGGCTACACCGTGGAGGAATGG - Intergenic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1119527535 14:75334123-75334145 CTGAATACCCCGAGGGGCCAGGG + Intergenic
1122573873 14:102728390-102728412 CTGTGTACACCGAGGGCGGCAGG + Exonic
1122882778 14:104697464-104697486 CTGTCTGCACCGCAGGGGCTAGG + Intronic
1128214073 15:65922412-65922434 CTGTGCACGCAGAGGGGGCATGG + Exonic
1128754186 15:70170314-70170336 CTGTTTACACCAAGAGGGCCTGG - Intergenic
1129200825 15:73998154-73998176 GTGTCTGCACCTAGGGGCCAGGG - Exonic
1129776666 15:78241339-78241361 CTGTCTACATCGAGTGGGTGGGG + Intronic
1132467341 16:83401-83423 CTGGCTACGCTGACGGGGCAGGG + Intronic
1133039482 16:3052761-3052783 CTGGCCACACCGGTGGGGCAAGG + Intronic
1136229256 16:28877310-28877332 ATGTCTAGACCTAGGGGGAAAGG - Intergenic
1136403623 16:30031135-30031157 CCCTCCCCACCGAGGGGGCAGGG - Exonic
1138607584 16:58098802-58098824 CTGTCTGCCCCGGGAGGGCAGGG - Intergenic
1140207601 16:72946570-72946592 CTTTCTACCCGGAGGGGGCGGGG - Intronic
1142275639 16:89117511-89117533 CTGTCTACACCCAGGGAGTCAGG + Intronic
1142275648 16:89117550-89117572 CTGTCTACACCGAGGATGTCAGG + Intronic
1142643867 17:1299897-1299919 CTGTCTACAGGGAGGGGCCCTGG + Exonic
1144723794 17:17491117-17491139 CTGTCCACCCCCAGAGGGCAGGG - Intronic
1151130794 17:71894303-71894325 GTGTCTACACCAAGGGGACGGGG + Intergenic
1152787342 17:82255644-82255666 CTGTGCACACCAAGGGGTCATGG + Intronic
1153819803 18:8823733-8823755 CTGGCTTCACCTTGGGGGCAAGG - Intronic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1162768904 19:12937490-12937512 CTTTCTACAGCGTGGGGGCAGGG + Intergenic
1166665682 19:44678854-44678876 CTGCCTGCTCCGAGGGGCCAGGG + Exonic
1167026380 19:46922098-46922120 CTCTCTAGAGCGAGGGCGCAAGG + Exonic
1167148927 19:47698084-47698106 CTCTCTGCACTGTGGGGGCAGGG - Intronic
928441624 2:31296973-31296995 CAGCCTACACCCAGGGGGCATGG + Intergenic
929059987 2:37914122-37914144 CTGTCCACACCCAGGGTACAAGG - Intergenic
942712136 2:178848508-178848530 CTGACTACACTGAGGGTGTAAGG + Intronic
943374213 2:187055088-187055110 TTGTATACACCCAGGTGGCATGG + Intergenic
1169698476 20:8418896-8418918 CTGCCTACACAGAGGGGAGAGGG + Intronic
1172771583 20:37385398-37385420 CTGTCTGCACCGCTGGGGCCCGG - Intronic
1173840186 20:46151988-46152010 CTGCCTACTCCTAGGGGTCATGG + Intergenic
1174566723 20:51470008-51470030 CTGACAACACCGAGGAGGCTGGG + Intronic
1177743618 21:25184137-25184159 CTGTCTACTACGGGGGGTCAGGG - Intergenic
1178817726 21:35946742-35946764 CTGTCAACCTCGAGGGGGCGGGG - Intronic
1181047871 22:20224122-20224144 CTGTCTTCACCGAGGCCGCAGGG + Intergenic
1181173041 22:21020944-21020966 ATGTCGACACAGAGGGGGCTTGG + Intronic
1183233424 22:36597484-36597506 CAGTCCTCACCGAGGGGGTAAGG + Intronic
1183382774 22:37498689-37498711 CTGGCTGCATCGAGGTGGCATGG + Intronic
1183587356 22:38760680-38760702 CTGTCTCCACGCAGGGGGCCTGG - Intronic
1183667832 22:39255430-39255452 CTGTCAACTCTGAGAGGGCAGGG - Intergenic
1184493456 22:44823852-44823874 CTGGCAACACTGAGGGTGCAGGG + Intronic
1185317397 22:50185063-50185085 CTGGGTACAGCGAGGGGGCCGGG + Intergenic
949942192 3:9163575-9163597 CTGTCAAAGCAGAGGGGGCAGGG + Intronic
950441700 3:13014470-13014492 CTGTCTGCAGCGTGGGGGCAGGG + Intronic
951930552 3:27962320-27962342 CTGTCTACACCCTGGAGACAGGG + Intergenic
955339238 3:58112179-58112201 CTGTCTACACCAAGGGGGCTGGG + Exonic
956678930 3:71759920-71759942 CTGTGTGCACCGAGGTGGCTGGG + Intergenic
960282029 3:115791048-115791070 CTGTCTAGACCTGGGGAGCATGG + Intergenic
969206767 4:5653021-5653043 CTGGCAACACCGAGCTGGCATGG - Intronic
985904783 5:2825072-2825094 CTGTGTACACCCAGGAGCCATGG - Intergenic
985931235 5:3059276-3059298 CTGTCTAGACCGCCTGGGCACGG + Intergenic
989517886 5:42364420-42364442 CTGCCTACCCAGAAGGGGCAAGG - Intergenic
1000089234 5:157915818-157915840 CTGTCCACACGGTGGTGGCAGGG - Intergenic
1002032695 5:176442240-176442262 CTGTTTACAATGAGGGGCCAGGG - Intergenic
1004963880 6:20824738-20824760 CTGCCTACACGTAGGGGGAAAGG + Intronic
1006299037 6:33184159-33184181 CTGTCTCCGCAGAGAGGGCAGGG + Intronic
1013807353 6:114010685-114010707 CTGTCTACACACAGGGATCAGGG + Intronic
1014761705 6:125363859-125363881 CTGACTACACCCAGGGGGTGGGG + Intergenic
1014913947 6:127121580-127121602 CTGTCTCCTCCGAGGACGCAAGG - Intronic
1019275449 7:173269-173291 CTGTGTCCACAGATGGGGCAGGG + Intergenic
1024563066 7:50660605-50660627 CCGTCTGCACCGAGAGGCCACGG - Intronic
1025189705 7:56887305-56887327 CTGGCCACCCCGAGGGGGCCCGG + Intergenic
1025682233 7:63689616-63689638 CTGGCCACCCCGAGGGGGCCCGG - Intergenic
1026461849 7:70621294-70621316 CTGTATTCACTGTGGGGGCAGGG + Intronic
1026523329 7:71134372-71134394 CTGTCTTCACTGTGGTGGCAAGG + Intronic
1026850206 7:73719197-73719219 CTGTCTACACCGAGGGGGCACGG + Intronic
1028505953 7:91570351-91570373 TTGTCAACACAGAGAGGGCAAGG - Intergenic
1034939622 7:155221850-155221872 CTGTCTTCCCCCCGGGGGCAGGG - Intergenic
1040075034 8:43220549-43220571 CTGTTTCCACAGAGTGGGCAGGG - Intergenic
1048598865 8:135897144-135897166 ATGTCTACACTGAGGGGCTATGG + Intergenic
1048646035 8:136420796-136420818 CTGTAAACACCGAGGGAGAATGG + Intergenic
1049500565 8:142961445-142961467 CTTTGTACAGCTAGGGGGCATGG - Intergenic
1050581074 9:7057747-7057769 CTGTCATCTCCGAGGGAGCAGGG + Intronic
1052443007 9:28521970-28521992 CTGTATCCATCGAGGGAGCATGG + Intronic
1056379745 9:86046569-86046591 TGGTCTACACCAAGGGGACAAGG + Exonic
1062194432 9:135265097-135265119 CTGTCCACAGCGAGGGGTCAGGG - Intergenic
1062663934 9:137656638-137656660 ATGTGTACACCCAGGAGGCAGGG + Intronic
1185756263 X:2655442-2655464 CTGTCTGCACCCAGGGGACCAGG - Intergenic
1188777957 X:34245276-34245298 ATTTCTACACTGAGGGGTCAGGG - Intergenic
1190339066 X:49282074-49282096 CTGTCTACTCCAAGGCTGCAAGG - Intronic
1197798951 X:130328891-130328913 CTGTCTGCACCATGGGGGCAGGG + Intergenic
1199895875 X:152127570-152127592 CTGCCAACACCAAAGGGGCAAGG + Intergenic