ID: 1026850520

View in Genome Browser
Species Human (GRCh38)
Location 7:73720422-73720444
Sequence TACTGGATGATGGGAGCAAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026850520_1026850528 -7 Left 1026850520 7:73720422-73720444 CCCCTTGCTCCCATCATCCAGTA No data
Right 1026850528 7:73720438-73720460 TCCAGTAGGGACTCAGGCACTGG No data
1026850520_1026850530 10 Left 1026850520 7:73720422-73720444 CCCCTTGCTCCCATCATCCAGTA No data
Right 1026850530 7:73720455-73720477 CACTGGCCTCTTCTTTCCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026850520 Original CRISPR TACTGGATGATGGGAGCAAG GGG (reversed) Intergenic
No off target data available for this crispr