ID: 1026850531

View in Genome Browser
Species Human (GRCh38)
Location 7:73720461-73720483
Sequence AGAAATCCTAGGGAAAGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026850531_1026850534 24 Left 1026850531 7:73720461-73720483 CCTCTTCTTTCCCTAGGATTTCT No data
Right 1026850534 7:73720508-73720530 GACCCACCCCTTTTTCCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026850531 Original CRISPR AGAAATCCTAGGGAAAGAAG AGG (reversed) Intergenic
No off target data available for this crispr