ID: 1026850532

View in Genome Browser
Species Human (GRCh38)
Location 7:73720471-73720493
Sequence CTGTGAACTGAGAAATCCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026850532_1026850534 14 Left 1026850532 7:73720471-73720493 CCCTAGGATTTCTCAGTTCACAG No data
Right 1026850534 7:73720508-73720530 GACCCACCCCTTTTTCCTGCAGG No data
1026850532_1026850539 21 Left 1026850532 7:73720471-73720493 CCCTAGGATTTCTCAGTTCACAG No data
Right 1026850539 7:73720515-73720537 CCCTTTTTCCTGCAGGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026850532 Original CRISPR CTGTGAACTGAGAAATCCTA GGG (reversed) Intergenic
No off target data available for this crispr