ID: 1026853415

View in Genome Browser
Species Human (GRCh38)
Location 7:73738442-73738464
Sequence GGCCGCTTCCGCTTTCCTAC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026853415_1026853426 23 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853426 7:73738488-73738510 GAGTCTGAGCCGGCGGAGACGGG 0: 1
1: 0
2: 0
3: 4
4: 101
1026853415_1026853427 24 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853427 7:73738489-73738511 AGTCTGAGCCGGCGGAGACGGGG 0: 1
1: 0
2: 0
3: 4
4: 66
1026853415_1026853425 22 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853425 7:73738487-73738509 AGAGTCTGAGCCGGCGGAGACGG 0: 1
1: 0
2: 0
3: 10
4: 154
1026853415_1026853420 -10 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853420 7:73738455-73738477 GGAAGCGGCCTGGCAGGGGAAGG 0: 1
1: 0
2: 13
3: 152
4: 659
1026853415_1026853423 13 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853423 7:73738478-73738500 ATCGAGGTCAGAGTCTGAGCCGG 0: 1
1: 0
2: 0
3: 15
4: 118
1026853415_1026853429 30 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853429 7:73738495-73738517 AGCCGGCGGAGACGGGGAAAGGG 0: 1
1: 0
2: 0
3: 6
4: 134
1026853415_1026853421 -3 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853421 7:73738462-73738484 GCCTGGCAGGGGAAGGATCGAGG 0: 1
1: 1
2: 0
3: 25
4: 307
1026853415_1026853428 29 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853428 7:73738494-73738516 GAGCCGGCGGAGACGGGGAAAGG 0: 1
1: 0
2: 1
3: 10
4: 238
1026853415_1026853424 16 Left 1026853415 7:73738442-73738464 CCTGTAGGAAAGCGGAAGCGGCC 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1026853424 7:73738481-73738503 GAGGTCAGAGTCTGAGCCGGCGG 0: 1
1: 0
2: 2
3: 15
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026853415 Original CRISPR GGCCGCTTCCGCTTTCCTAC AGG (reversed) Exonic
901537598 1:9892619-9892641 GGCCACTGCCTCTTTCCAACAGG + Intronic
903368766 1:22821138-22821160 TACCGCTTCCTCTTTCCTCCTGG - Intronic
914947568 1:152080253-152080275 GGCTGCTTCCCCATTGCTACAGG + Intergenic
919847027 1:201648757-201648779 CGCCGCTGCCGCCTTCCTGCCGG - Exonic
921395635 1:214666219-214666241 GACCTCTTCCACTTTCCAACTGG + Intergenic
1065092785 10:22252203-22252225 GGCCTCCTGCGCTTTCCTTCGGG - Intergenic
1066026417 10:31363495-31363517 GGCTGCTTCCCCATTGCTACAGG + Intronic
1067406442 10:46028122-46028144 GGGCCCTTGCGCTTTCCTCCAGG + Intronic
1072784926 10:98272973-98272995 GGCCGCTGCAGCTTTCCGAAAGG + Intergenic
1076603850 10:131676954-131676976 GGCCACTTCCACATTCCTCCTGG - Intergenic
1080458342 11:32434556-32434578 CGCCGCTTCCGCTATCCTCACGG + Intronic
1081338648 11:41900483-41900505 GGCTGTTTCTGCTTTCCTATTGG + Intergenic
1083416697 11:62530491-62530513 GGGCCCTTCAGCTTTCCTTCCGG + Exonic
1083416879 11:62531622-62531644 GGGCCCTTCAGCTTTCCTTCAGG + Exonic
1083457327 11:62787586-62787608 GGCCACTTTCGCTTTCCGACCGG + Intronic
1088170427 11:106990172-106990194 GGCTGCTTCCTCTTTCCAGCTGG - Intronic
1110626777 13:77662072-77662094 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1128322512 15:66703321-66703343 CGCCGCTGCCGCCTTCCTCCCGG - Exonic
1132141837 15:99403380-99403402 GGCAGCTTCCATTTTCCTTCCGG - Intergenic
1134215147 16:12311489-12311511 GGCCGCCTCCCATTTCCTCCAGG + Intronic
1136580956 16:31150389-31150411 GGCCACTTCCCCTGTCCTAAGGG - Intergenic
1138829428 16:60359151-60359173 GGCCGCTTCCCCATTGCTACAGG + Exonic
1139505550 16:67396542-67396564 GGCCCCTCCCGCATTCCTGCTGG + Intronic
1139778306 16:69330706-69330728 GCCCCCTTCCGCTCTCCTCCCGG + Intronic
1143584150 17:7843090-7843112 TGCCACTTCCCCTTTCCCACGGG - Intronic
1144509228 17:15860951-15860973 GGCCACTTCCACTTTCCCTCTGG - Intergenic
1145173346 17:20678596-20678618 GGCCACTTCCACTTTCCCTCTGG - Intergenic
1147133282 17:38421087-38421109 AGCCGCTTCCCCTTTCCCAGAGG + Intergenic
1147666999 17:42155106-42155128 CGCCACTCCCGCGTTCCTACCGG - Intergenic
1149778491 17:59377589-59377611 GGCAGCATCTGCTTTCCCACTGG + Intronic
1150622028 17:66814797-66814819 GCCCGCTTCCTCCTTCCTCCTGG - Intergenic
1151632676 17:75321574-75321596 GGGCGCCTCCCCTTTCCTACAGG + Intronic
1152901591 17:82944259-82944281 GGCCACTGCCTCTTTCCCACTGG + Intronic
1154194141 18:12253870-12253892 GGCAGCTTCCGCATCCCTGCAGG + Intergenic
1158648064 18:59264891-59264913 GGGCGCCTCCGCGGTCCTACGGG + Intergenic
1161169325 19:2805133-2805155 GGCCTCCTCCACTTTCCTCCTGG - Exonic
1163630414 19:18415450-18415472 GGCCGCCTCCGCCTTCCTCTGGG - Intergenic
1166998507 19:46731274-46731296 GGCCGGTTCCTCTTTCCTGCAGG - Intronic
926089798 2:10042843-10042865 GGCCTCTTCCGCTCTGTTACGGG - Intronic
926144821 2:10390627-10390649 GGCCACTTCCGGTTTTCTGCAGG + Intronic
932063335 2:68528910-68528932 GGCTGCTTCCCCATTGCTACAGG + Intronic
933732275 2:85466197-85466219 GGCAGCTTCTGCTTGCCTTCTGG + Intergenic
937030674 2:118737290-118737312 GGCCCCTTCCCCTGTCCTAAGGG + Intergenic
941441141 2:165538320-165538342 GGCCTGTCCCACTTTCCTACTGG - Intronic
942953776 2:181750801-181750823 GGCCCCTTGCGCTTCCCTAAAGG + Intergenic
944536092 2:200711360-200711382 GTCTGCTTCAGCTTTCCGACAGG + Intergenic
1170874481 20:20237342-20237364 GGTCGCATCCTCATTCCTACAGG + Intronic
1174479090 20:50818381-50818403 GGCCGCTGCCCCATTCCTCCTGG - Intronic
1177897219 21:26868009-26868031 GGTCTCTTCCCCTTTCCTCCGGG - Intergenic
1179784079 21:43719794-43719816 GGCCGCTTCTGCGTTCCAGCGGG - Intronic
1181124037 22:20691357-20691379 CGCCTCTTCCGCTTTCGTCCCGG - Intergenic
955260525 3:57384916-57384938 GGCTTCTTCAGCTTTCCCACTGG + Intronic
964195533 3:154059831-154059853 GGGCTCTTCCTCTTTCCTTCTGG - Intergenic
973736279 4:53874749-53874771 GGCGGAGTCCCCTTTCCTACCGG + Intronic
977560683 4:98530488-98530510 AGCCGTTTCCACTTTCCTAGAGG + Intronic
977666603 4:99651749-99651771 GGCAGCTTCAGCTTCCCTATAGG + Exonic
985492793 5:189140-189162 GGCCTCTTTTGCTTTCCTCCTGG + Exonic
992124339 5:73625945-73625967 GGCAGCTTCAGGTTTCCTCCTGG + Intergenic
1001959718 5:175872595-175872617 GGCCACTTCCGCTTTTCAGCCGG + Intronic
1004564421 6:16782047-16782069 GGCTGCTTCCCCCTTCCCACTGG + Intergenic
1006919048 6:37615568-37615590 GCCAGCTTCCTCCTTCCTACTGG - Intergenic
1007584300 6:42979228-42979250 GGCCGCTTCCGCTTCCGTCAGGG + Intergenic
1009398635 6:63229782-63229804 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1018908652 6:168089405-168089427 GGCCGCTTCCTCCTTCGTTCAGG + Intergenic
1026853415 7:73738442-73738464 GGCCGCTTCCGCTTTCCTACAGG - Exonic
1038373014 8:27011817-27011839 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1056020279 9:82432578-82432600 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1056576425 9:87858730-87858752 GGCTGCTTCCCCATTGCTACAGG + Intergenic
1057249563 9:93489480-93489502 GGTGGCTTCAGCTGTCCTACTGG - Intronic
1059925249 9:119202940-119202962 GGCCTCTTCTGGTTACCTACAGG + Intronic
1060478306 9:124000952-124000974 GGCAGCTGCCCCTTTCCTGCGGG - Intergenic
1062331094 9:136045259-136045281 GTCCGCTTCCCCTTCCCTTCTGG - Intronic
1062463076 9:136669961-136669983 GGCCGCTGCCGCTGCCCTGCAGG + Exonic
1192557610 X:72102995-72103017 GGCAGCCTCTGCTTTGCTACTGG - Intergenic
1194378240 X:93162615-93162637 TGCCACTTCTGCTTTCCTTCTGG + Intergenic
1200222650 X:154398906-154398928 GGCCGCCTCCTGTGTCCTACAGG + Intronic
1202057353 Y:20848694-20848716 GGCTGCATCCACTTTCCAACCGG + Intergenic