ID: 1026854255

View in Genome Browser
Species Human (GRCh38)
Location 7:73742778-73742800
Sequence CCTCATCAGCAGAATAAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026854255_1026854259 -9 Left 1026854255 7:73742778-73742800 CCGTCCTTATTCTGCTGATGAGG No data
Right 1026854259 7:73742792-73742814 CTGATGAGGAAAGAGAGGCTTGG No data
1026854255_1026854261 15 Left 1026854255 7:73742778-73742800 CCGTCCTTATTCTGCTGATGAGG No data
Right 1026854261 7:73742816-73742838 CGGCGAAGTAACCCAGCTCCAGG No data
1026854255_1026854260 -5 Left 1026854255 7:73742778-73742800 CCGTCCTTATTCTGCTGATGAGG No data
Right 1026854260 7:73742796-73742818 TGAGGAAAGAGAGGCTTGGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026854255 Original CRISPR CCTCATCAGCAGAATAAGGA CGG (reversed) Intergenic
No off target data available for this crispr