ID: 1026858043

View in Genome Browser
Species Human (GRCh38)
Location 7:73767980-73768002
Sequence GAGAGATTCAAATGACTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026858043_1026858050 5 Left 1026858043 7:73767980-73768002 CCATCCAGTCATTTGAATCTCTC No data
Right 1026858050 7:73768008-73768030 CACCAAGTCACCCTGTGCCTGGG No data
1026858043_1026858049 4 Left 1026858043 7:73767980-73768002 CCATCCAGTCATTTGAATCTCTC No data
Right 1026858049 7:73768007-73768029 CCACCAAGTCACCCTGTGCCTGG No data
1026858043_1026858052 11 Left 1026858043 7:73767980-73768002 CCATCCAGTCATTTGAATCTCTC No data
Right 1026858052 7:73768014-73768036 GTCACCCTGTGCCTGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026858043 Original CRISPR GAGAGATTCAAATGACTGGA TGG (reversed) Intergenic
No off target data available for this crispr