ID: 1026858052

View in Genome Browser
Species Human (GRCh38)
Location 7:73768014-73768036
Sequence GTCACCCTGTGCCTGGGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026858042_1026858052 21 Left 1026858042 7:73767970-73767992 CCTTTATGTTCCATCCAGTCATT No data
Right 1026858052 7:73768014-73768036 GTCACCCTGTGCCTGGGTTCAGG No data
1026858043_1026858052 11 Left 1026858043 7:73767980-73768002 CCATCCAGTCATTTGAATCTCTC No data
Right 1026858052 7:73768014-73768036 GTCACCCTGTGCCTGGGTTCAGG No data
1026858044_1026858052 7 Left 1026858044 7:73767984-73768006 CCAGTCATTTGAATCTCTCGCCC No data
Right 1026858052 7:73768014-73768036 GTCACCCTGTGCCTGGGTTCAGG No data
1026858040_1026858052 29 Left 1026858040 7:73767962-73767984 CCTGTCTCCCTTTATGTTCCATC No data
Right 1026858052 7:73768014-73768036 GTCACCCTGTGCCTGGGTTCAGG No data
1026858041_1026858052 22 Left 1026858041 7:73767969-73767991 CCCTTTATGTTCCATCCAGTCAT No data
Right 1026858052 7:73768014-73768036 GTCACCCTGTGCCTGGGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026858052 Original CRISPR GTCACCCTGTGCCTGGGTTC AGG Intergenic
No off target data available for this crispr