ID: 1026858346

View in Genome Browser
Species Human (GRCh38)
Location 7:73769383-73769405
Sequence TCCCTTAGACGTAGTCCTTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026858346 Original CRISPR TCCCTTAGACGTAGTCCTTG CGG Exonic