ID: 1026863312

View in Genome Browser
Species Human (GRCh38)
Location 7:73807901-73807923
Sequence GTGGGGGCAGCTGGTGCTCG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 362}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026863296_1026863312 25 Left 1026863296 7:73807853-73807875 CCTAAAGTGGGGAGACAGTGTTG 0: 1
1: 0
2: 1
3: 19
4: 178
Right 1026863312 7:73807901-73807923 GTGGGGGCAGCTGGTGCTCGTGG 0: 1
1: 0
2: 3
3: 36
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026863312 Original CRISPR GTGGGGGCAGCTGGTGCTCG TGG Intronic