ID: 1026863633

View in Genome Browser
Species Human (GRCh38)
Location 7:73809800-73809822
Sequence CCCCAGGGCCCGGTTTCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026863619_1026863633 17 Left 1026863619 7:73809760-73809782 CCACCATTCCGCCATTGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 180
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863624_1026863633 0 Left 1026863624 7:73809777-73809799 CCCTGGAGAAGCTTCTTCCCTGT 0: 1
1: 0
2: 1
3: 24
4: 295
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863616_1026863633 20 Left 1026863616 7:73809757-73809779 CCCCCACCATTCCGCCATTGCCC 0: 1
1: 0
2: 0
3: 19
4: 192
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863617_1026863633 19 Left 1026863617 7:73809758-73809780 CCCCACCATTCCGCCATTGCCCT 0: 1
1: 0
2: 0
3: 12
4: 192
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863618_1026863633 18 Left 1026863618 7:73809759-73809781 CCCACCATTCCGCCATTGCCCTG 0: 1
1: 0
2: 1
3: 13
4: 156
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863621_1026863633 14 Left 1026863621 7:73809763-73809785 CCATTCCGCCATTGCCCTGGAGA 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863623_1026863633 6 Left 1026863623 7:73809771-73809793 CCATTGCCCTGGAGAAGCTTCTT 0: 1
1: 1
2: 2
3: 189
4: 1738
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863622_1026863633 9 Left 1026863622 7:73809768-73809790 CCGCCATTGCCCTGGAGAAGCTT 0: 1
1: 0
2: 0
3: 16
4: 193
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data
1026863625_1026863633 -1 Left 1026863625 7:73809778-73809800 CCTGGAGAAGCTTCTTCCCTGTC 0: 1
1: 0
2: 1
3: 27
4: 260
Right 1026863633 7:73809800-73809822 CCCCAGGGCCCGGTTTCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026863633 Original CRISPR CCCCAGGGCCCGGTTTCACT GGG Intronic
No off target data available for this crispr