ID: 1026864075

View in Genome Browser
Species Human (GRCh38)
Location 7:73811789-73811811
Sequence CTGTGCTAGTGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 323
Summary {0: 1, 1: 0, 2: 1, 3: 48, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026864075_1026864081 5 Left 1026864075 7:73811789-73811811 CCCTCCACCTGCCACTAGCACAG 0: 1
1: 0
2: 1
3: 48
4: 273
Right 1026864081 7:73811817-73811839 ATTTTCAAAATTCCCATCAACGG No data
1026864075_1026864083 11 Left 1026864075 7:73811789-73811811 CCCTCCACCTGCCACTAGCACAG 0: 1
1: 0
2: 1
3: 48
4: 273
Right 1026864083 7:73811823-73811845 AAAATTCCCATCAACGGGTGTGG No data
1026864075_1026864082 6 Left 1026864075 7:73811789-73811811 CCCTCCACCTGCCACTAGCACAG 0: 1
1: 0
2: 1
3: 48
4: 273
Right 1026864082 7:73811818-73811840 TTTTCAAAATTCCCATCAACGGG No data
1026864075_1026864084 12 Left 1026864075 7:73811789-73811811 CCCTCCACCTGCCACTAGCACAG 0: 1
1: 0
2: 1
3: 48
4: 273
Right 1026864084 7:73811824-73811846 AAATTCCCATCAACGGGTGTGGG 0: 1
1: 0
2: 1
3: 4
4: 77
1026864075_1026864087 21 Left 1026864075 7:73811789-73811811 CCCTCCACCTGCCACTAGCACAG 0: 1
1: 0
2: 1
3: 48
4: 273
Right 1026864087 7:73811833-73811855 TCAACGGGTGTGGGACACCCTGG 0: 1
1: 0
2: 1
3: 5
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026864075 Original CRISPR CTGTGCTAGTGGCAGGTGGA GGG (reversed) Intronic
900126674 1:1071852-1071874 CTGTGCTGGTGGCCGGGGGCCGG + Exonic
900862501 1:5243525-5243547 CTGTCCTAGAGGCATGTGGGTGG + Intergenic
903609087 1:24596983-24597005 CTGTGGTTCTGGCAGGTGGCTGG + Intronic
903681385 1:25099606-25099628 CTGAGCTAGTGACAGGAGGCAGG - Intergenic
905504368 1:38465498-38465520 CTGGGCCAGAGGCAGGAGGAGGG - Intergenic
906258900 1:44371268-44371290 CTGGGGTAGTAGCAGGTGAATGG + Intergenic
906991494 1:50744186-50744208 CTTGGATAGTGGCAGGTGCATGG - Intronic
908813964 1:68012633-68012655 CTGTGCCTGCTGCAGGTGGAAGG - Intergenic
909204548 1:72738604-72738626 CTGTGCTAGTGGCAAGTAATTGG + Intergenic
911935095 1:103960228-103960250 CTGTGCTGGTGGAGGGTGGGAGG + Intergenic
912774040 1:112492559-112492581 CTGTGCTTCTGGCTGGGGGAAGG + Intronic
913451755 1:118997554-118997576 CTTTGCTGGGGGCAGGTGGGAGG - Intergenic
913578152 1:120197507-120197529 CTGTGGTGGAGGCAGGAGGAGGG + Intergenic
915598942 1:156910399-156910421 CCCTGCTGGTGGCAGGTGGAAGG - Intronic
916212223 1:162368251-162368273 CTGGGCTACAGGCAGGAGGAAGG - Exonic
918358056 1:183724575-183724597 CTCTGCTTGTGGAAGGGGGAGGG + Intronic
918385714 1:184005398-184005420 CTTTGCTAGTGGCAGAAGGATGG + Intronic
918407308 1:184223744-184223766 AGGTGCTACTGGCACGTGGAGGG - Intergenic
919685973 1:200483968-200483990 CAGTGCTAAGGGCAGGTTGATGG - Intergenic
919800030 1:201348364-201348386 CTGTCCTGGTGGGAGGTGGGCGG + Intergenic
919923779 1:202181756-202181778 CTGTGCTGGAGGCGGGTGAAGGG + Intergenic
920041063 1:203097660-203097682 TTGTGCTGGTGAAAGGTGGAAGG + Intronic
920295973 1:204956656-204956678 CTGTGCTAGGTGCTGGTGAAAGG - Intronic
922702431 1:227769698-227769720 CTGTGGTTGTGGAGGGTGGAGGG + Intronic
923540308 1:234884096-234884118 ATGTGACAGTGGCAGGTGAAGGG + Intergenic
923974448 1:239245818-239245840 CTGGGCTAGTGACATGTGGTAGG - Intergenic
924786177 1:247202135-247202157 GTGTGCTGGTTGCAGGTGAAAGG - Intergenic
1062783929 10:244555-244577 CTGCGAGAGTGGCTGGTGGATGG + Intronic
1063239157 10:4150658-4150680 CTATGCTGGTGGCCCGTGGAAGG - Intergenic
1063552110 10:7043157-7043179 CTGGGCTAGAGGGAGGTGGCAGG + Intergenic
1063618971 10:7627403-7627425 CTGTGCTAGTCTCTGGTCGAGGG + Intronic
1064111235 10:12540999-12541021 CTGTGTAATTGTCAGGTGGAGGG + Intronic
1064535224 10:16351235-16351257 CTGTCTCGGTGGCAGGTGGAGGG - Intergenic
1064624747 10:17251045-17251067 CTGGGGTAGAGGCAGGTGGATGG - Intergenic
1066421886 10:35271455-35271477 CTGTGCTTCTGGCAGGGGGAAGG + Intronic
1067258446 10:44665773-44665795 CTGTGCTGATTTCAGGTGGAGGG - Intergenic
1067821057 10:49530767-49530789 CTCTGCTGGTGGCAGCTTGAGGG + Exonic
1068901665 10:62276667-62276689 CTCTGCCAATGGCAAGTGGAAGG - Intergenic
1069690434 10:70348252-70348274 CTGTGTTAGTGGCTGGTGATGGG - Intronic
1070377175 10:75843985-75844007 CTGTGGTAGTGGCAGCAGAAAGG + Intronic
1072564976 10:96609939-96609961 CTGTGAGAGAGGCAGGTGGAGGG - Intronic
1073477112 10:103761638-103761660 CTGTGTGGGTGGCAGGTGGCTGG - Intronic
1074261497 10:111858042-111858064 CTGTTCTGGGGGCAGGAGGAGGG - Intergenic
1074444057 10:113503969-113503991 TTCTGCTAGTAGCAAGTGGATGG - Intergenic
1075786958 10:125056661-125056683 CCGTTCTAGAGGCAGGAGGATGG - Intronic
1075808805 10:125209387-125209409 CTGAGCTAGAGGAATGTGGAAGG - Intergenic
1076093692 10:127712990-127713012 CTGTCGCAGTGGCAGGTGCATGG - Intergenic
1077136727 11:1003258-1003280 CTGTGCTGCTGGTGGGTGGATGG + Intronic
1079446581 11:20562245-20562267 CTGTGCTTGGGGCAGGAGGTTGG - Intergenic
1083178164 11:60965939-60965961 CTGGGGTAGAGGCATGTGGATGG + Intergenic
1083271628 11:61575824-61575846 GTGTGCGGGTGGCAGCTGGATGG - Intronic
1083541813 11:63516473-63516495 ATGTGCTGGTGTCAGGTGGATGG - Exonic
1083720625 11:64601905-64601927 CTGAGCTCTGGGCAGGTGGACGG - Exonic
1084658138 11:70531322-70531344 CTGTGCTGGGGGCTGGTGGTGGG + Intronic
1084805542 11:71576597-71576619 CTGTGGGAATGGCAGGTGGTGGG + Intergenic
1085122075 11:73973690-73973712 CTGGGGCAGGGGCAGGTGGAGGG + Intergenic
1085845155 11:80056603-80056625 ATGTGCTTGTGGGAAGTGGATGG - Intergenic
1086947571 11:92858329-92858351 CTGTGCACATAGCAGGTGGATGG + Intronic
1087181118 11:95143625-95143647 CAGGGCCAGTGGCAGGAGGATGG + Intergenic
1089618355 11:119707924-119707946 CAGTGGTAGTGGCAAGAGGAAGG + Intronic
1090482112 11:127078020-127078042 CTGGGCTGGGGGCAGGAGGATGG - Intergenic
1091779998 12:3207763-3207785 CTGTTTTAGTGGCTGGTGGGGGG + Intronic
1092001824 12:5039031-5039053 CTGTGCTGGGGACAGGTGGCTGG - Intergenic
1092122827 12:6056675-6056697 CTGTCCTGCTGGGAGGTGGAAGG + Intronic
1092337804 12:7649213-7649235 TTGTGCTAGTGGCTGGTAGAAGG - Intergenic
1093925545 12:24904761-24904783 CTGGGCTAGTTGCTGGGGGAGGG + Intronic
1098918364 12:76280040-76280062 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1098918389 12:76280215-76280237 CTGGGCTAGGGCCAGGTGGAAGG + Intergenic
1101624540 12:106426110-106426132 CAGTGCTGCTGGCAGGAGGAGGG - Intronic
1102277867 12:111597847-111597869 CGGTGCTGGTGGCAGGGGGCGGG - Intronic
1102924452 12:116816086-116816108 CTGTCCTGGTCCCAGGTGGATGG - Intronic
1104323049 12:127770264-127770286 ATGTGATAGTGGCATCTGGAAGG + Intergenic
1106512095 13:30421382-30421404 TCGTGCTGGTGGCAGGTGGATGG - Intergenic
1106620917 13:31369873-31369895 GTGTGCTGGTGGTAGGTGGTAGG + Intergenic
1107598466 13:41988294-41988316 CTGTGGTTATGGCAGGTAGAAGG - Intergenic
1107980169 13:45727600-45727622 CTGTGCTTCTGGCAGGAGGAGGG - Intergenic
1108800068 13:54084095-54084117 CTGTGTGACTGGCAGGTGGTCGG - Intergenic
1108922586 13:55693852-55693874 CTGTGCTAGTGGTAGCTACAGGG + Intergenic
1109123747 13:58490938-58490960 CAGTGCTAGTGGGTGGTGGTGGG - Intergenic
1115603998 14:34982392-34982414 CAGAGCTAGAGGCAGGTGGTGGG - Intronic
1117284057 14:54269089-54269111 CTGTGCTTGTCACTGGTGGATGG - Intergenic
1117420723 14:55542535-55542557 TTGTGCTTCTGGCAGGGGGAGGG + Intergenic
1117728958 14:58702303-58702325 CTTTGCTGGTGGCAGGGGGATGG + Intergenic
1119577563 14:75740613-75740635 CTTTGAAATTGGCAGGTGGAGGG - Intronic
1120705996 14:87746352-87746374 CCATGCTAGTGGCAGGTGAAGGG - Intergenic
1123029763 14:105446171-105446193 CTGTGTCAGTAGCATGTGGAGGG - Intronic
1123154318 14:106209838-106209860 CTGTGCTCCCTGCAGGTGGAGGG - Intergenic
1123682552 15:22773147-22773169 CTGTGAAAGTGCCAGGTTGAAGG + Intronic
1123762532 15:23443933-23443955 CTGTGAAAGTGCCAGGTTGAAGG + Exonic
1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG + Intergenic
1124334302 15:28845671-28845693 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
1125930080 15:43594006-43594028 ATGAGCTAGTGGCAGGCGGGCGG - Intronic
1125943248 15:43693838-43693860 ATGAGCTAGTGGCAGGCGGGCGG - Exonic
1128058777 15:64720145-64720167 CTGTGCCACTGGAAGGTAGAAGG - Intergenic
1129366188 15:75056593-75056615 CTGTCCTTGTGGCCAGTGGAGGG + Intronic
1130118320 15:81024735-81024757 CTGTGGTGGAGGCAGGGGGAAGG + Intronic
1131832235 15:96361282-96361304 CTGTGACAGTGGCACCTGGAAGG - Intergenic
1131859481 15:96637234-96637256 CTATGATAATGGCAGGTGGGTGG + Intergenic
1132200679 15:99952632-99952654 ATGGGCTGGGGGCAGGTGGAGGG + Intergenic
1132494349 16:253999-254021 CTGTGCTTGAGGCTGGTGGAAGG + Intronic
1132885883 16:2181717-2181739 CTGGGCTGGTGGCTGGTGGCTGG + Intronic
1132891449 16:2206859-2206881 CTAAGCCAGTGGCTGGTGGAAGG - Intronic
1135407426 16:22207910-22207932 CTGGGGAAGAGGCAGGTGGAAGG + Intronic
1138498696 16:57425090-57425112 CTGTCCTTGTGGCAGGGAGAAGG - Intergenic
1138729770 16:59182283-59182305 CTGTGCCAGTGGCAGTAGGGTGG + Intergenic
1140022048 16:71247957-71247979 CTGTGTGCGTGGCAGGGGGAGGG + Intergenic
1140219548 16:73033636-73033658 CTGTGAAAGTGTGAGGTGGAAGG - Intronic
1140246206 16:73252343-73252365 CTGGGGTAGTGGCATGGGGACGG + Intergenic
1140339979 16:74148317-74148339 CTGTGGGAGAGGCAGGTGGATGG - Intergenic
1141031060 16:80588988-80589010 CTGTGATAGGGGCAAGAGGAAGG + Intergenic
1141131673 16:81441692-81441714 CTGGGATAGTGGAAGGTGGAGGG + Intergenic
1141383123 16:83593873-83593895 CTGTGGTAGTGGTAGGTGCTGGG + Intronic
1142184927 16:88690311-88690333 CAGTGCCAGTGCCAGGTGGCTGG + Intergenic
1142276358 16:89120922-89120944 CTCTGCTCTTGGCAGGTGGGCGG + Intronic
1146791095 17:35751026-35751048 CTGGGCTACTGGCTGGTGGCTGG - Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150251248 17:63705922-63705944 CGGTGGTAGGGGCAGCTGGAGGG - Intronic
1150287900 17:63964293-63964315 CTTTGCTGGTGGCAGGGGGATGG - Intronic
1151374790 17:73680126-73680148 CTGTGTTTATGGCAGGTGGGAGG + Intergenic
1155332077 18:24728638-24728660 CTGTGATAGAGGCTGGGGGAAGG - Intergenic
1155852817 18:30793748-30793770 CTGTGAAAGAGGCATGTGGATGG - Intergenic
1156263728 18:35467691-35467713 CTGTGCAAGTGGCAGCTGCCTGG - Intronic
1156994388 18:43448228-43448250 CTTTGGTAGTAGCAGGTGCAGGG - Intergenic
1157218571 18:45807011-45807033 CAGTGCTATTGGCAGGCGGGGGG + Intergenic
1158002349 18:52633971-52633993 CCCTGCTCATGGCAGGTGGATGG + Intronic
1161063460 19:2226623-2226645 CTGAGCAAGAGGCAGCTGGACGG + Exonic
1162945255 19:14039528-14039550 CTGTGGCAGTGGCAGCCGGACGG + Exonic
1163179140 19:15586457-15586479 CTGTGGTGGGGGCAGGAGGAGGG - Intergenic
1165348342 19:35262757-35262779 CTGTCCTGGGGGCAGGTGGATGG - Intronic
1165831926 19:38734781-38734803 CTGGGATAGGGGCAGGAGGAGGG - Intronic
1165974762 19:39665995-39666017 CTCTGCTAGGGCCATGTGGAAGG - Intergenic
1165997951 19:39858469-39858491 CTGGGCTCGTTGCCGGTGGAAGG + Intergenic
1166407104 19:42529049-42529071 CTGTGATAGAGGGAGGTGGGTGG + Intronic
1167158177 19:47751708-47751730 CTGTGCTGGAGCCAGGTGGCTGG + Intronic
1167668823 19:50838413-50838435 CTGTGCTGGGGGAAGCTGGAGGG + Intergenic
925077705 2:1032081-1032103 CATTGCTTGTGACAGGTGGAAGG + Intronic
925392412 2:3505516-3505538 CTGTGCTTCTGGCAGAGGGAGGG + Intronic
926204721 2:10828014-10828036 CTGTGTGTGTGGCAGGGGGAGGG - Intronic
926300387 2:11597811-11597833 CTGCGCTACTGCCAGCTGGAAGG - Exonic
926349645 2:11983382-11983404 CAGTGCTAGAGGCAGTGGGATGG - Intergenic
927224076 2:20744677-20744699 ATGTGCTTCTGGCAGGGGGAAGG - Intronic
927485281 2:23484615-23484637 CTGTGCTAATGGCAGGGGTGTGG - Intronic
927490000 2:23515028-23515050 CTGGGCTAGTGTTGGGTGGAGGG - Intronic
931122922 2:59240545-59240567 CTTTTCTAGAGGCAGGAGGATGG - Intergenic
932617659 2:73244963-73244985 CTGTGTCAGTGGGTGGTGGAGGG + Intronic
933912656 2:86956949-86956971 CTGTGTCAGTGGCAAGTGGATGG + Intronic
934010338 2:87812941-87812963 CTGTGTCAGTGGCAAGTGGATGG - Intronic
934617950 2:95786719-95786741 GGGTGCTAGTGGCAGGAGAATGG - Intergenic
934642943 2:96037840-96037862 GGGTGCTAGTGGCAGGAGAATGG + Intronic
934951476 2:98578629-98578651 GTGTGCTAGGGGCAGGCGGATGG - Intronic
935147859 2:100408469-100408491 CTGAGGTAGTGGTAGGAGGAGGG - Intronic
935366160 2:102293103-102293125 CAGTGCAGTTGGCAGGTGGAGGG + Intergenic
935773905 2:106453661-106453683 CTGTGTCAGTGGCAAGTGGATGG - Intronic
935906158 2:107842252-107842274 CTGTGTCAGTGGCAAGTGGATGG + Intronic
935992627 2:108734775-108734797 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936127946 2:109807417-109807439 CTGTGTCAGTGGCAAGTGGATGG + Intronic
936216751 2:110564068-110564090 CTGTGTCAGTGGCAAGTGGATGG - Intronic
936425890 2:112418649-112418671 CTGTGTCAGTGGCAAGTGGATGG - Intronic
937151963 2:119692197-119692219 CTGAGCTGGTGGCAGCTGGTGGG + Intergenic
937360999 2:121230126-121230148 CTGTGCTGGTGGGAGCGGGATGG - Intronic
937883678 2:126886281-126886303 CTGGGCTAGGGCCAGGTGGCCGG - Intergenic
937979317 2:127605187-127605209 CTGGGCTAGTGGCCAGAGGAGGG + Intronic
938230858 2:129657555-129657577 TTGTGCTTCTGGCAGGGGGAGGG - Intergenic
938889812 2:135692798-135692820 CTGTGGTAGTGGCAGTAGGAGGG + Intronic
939405009 2:141745415-141745437 CTCTGCCAGTGGAAGGGGGAGGG - Intronic
940554568 2:155207111-155207133 CGTTACCAGTGGCAGGTGGAAGG + Intergenic
942198234 2:173544192-173544214 CTGGGCTAGTGGCTGGAGGCTGG - Intergenic
944023885 2:195140906-195140928 CTCTGGTAGTGCAAGGTGGATGG + Intergenic
945198206 2:207257013-207257035 CTGTGCATGTGGCAGGGGGAAGG + Intergenic
946022495 2:216650642-216650664 CTGTGGTAGCTGCAGGTGGAGGG + Intronic
946028299 2:216685747-216685769 CAGTGGTTGTGGCAGGGGGAAGG + Intronic
946320649 2:218952307-218952329 CTGTGATGGTGGAAGGTGGAGGG + Intergenic
946400252 2:219464884-219464906 CTTGGCCAGTGGCAGGTGCAGGG - Intronic
947744622 2:232501224-232501246 ATGTGCCAGGGGCAGGGGGAAGG - Intergenic
948964101 2:241362933-241362955 CTGTGGTTCTGGGAGGTGGAGGG + Intronic
949028098 2:241775649-241775671 CGGTGCTAACGGCAGGTGGGAGG - Intergenic
949032328 2:241802951-241802973 CTGTGCCAGGGGCCCGTGGAGGG + Intronic
1169404298 20:5310610-5310632 CTGTACAGGTGGCAGGTGGTAGG - Intronic
1170364915 20:15588006-15588028 CTCTGCTAGTGCAATGTGGAAGG - Intronic
1172442360 20:34974897-34974919 CTTTTCTAGTGGCAGGAGGTAGG + Intergenic
1172477370 20:35248956-35248978 CTCAGAGAGTGGCAGGTGGATGG + Intronic
1174861148 20:54092479-54092501 CTGAGCTAGAGGCAGGTGGGTGG - Intergenic
1175470892 20:59226930-59226952 CTGTCCTAATGTCAGGTGAATGG - Intronic
1175735633 20:61385201-61385223 CTCTGGAAGTGGCAGGAGGAGGG + Intronic
1175779940 20:61675973-61675995 CTGTGCTCTGGGCAGGAGGAGGG - Intronic
1176097065 20:63349146-63349168 ATGGGCTGGTGGCAGGAGGACGG - Intronic
1179019546 21:37625980-37626002 GTGTGTTAATGGCAGGTGGGAGG - Intronic
1179078831 21:38150959-38150981 GTGTGATAGTGGGAGGAGGATGG + Intronic
1179257061 21:39726371-39726393 CTGGGATAGTGGCATGTGGATGG + Intergenic
1179720834 21:43315317-43315339 GTGTTCTAGTGGCAGGAAGAGGG + Intergenic
1180002081 21:44999738-44999760 CTGTGTTGGTGGCAGGTGGCCGG + Intergenic
1181540034 22:23568059-23568081 CTGTCATTCTGGCAGGTGGAGGG - Intergenic
1182085272 22:27556927-27556949 CTGTGCTGGGGCCAGGTGGAGGG - Intergenic
1183107157 22:35622771-35622793 CTGTCCAGGTGACAGGTGGATGG - Intronic
1184651935 22:45923396-45923418 CTGGGCTAGAGGCAGGGGTAGGG - Intronic
949570219 3:5285378-5285400 CTGTGATATTGGCAACTGGATGG + Intergenic
950253091 3:11483182-11483204 CTGGGTTAGGGGCAGGGGGACGG - Intronic
950655666 3:14434794-14434816 CCGTGCCAGTTGCAGGGGGAGGG - Intronic
950854869 3:16095587-16095609 CTGCTCTAGTGGCTGGAGGAAGG + Intergenic
951274678 3:20671030-20671052 CTGTGGAAGTGGCAGATGGTAGG + Intergenic
952141176 3:30480591-30480613 CTCTGCTAGTGCAATGTGGAAGG + Intergenic
952400005 3:32954587-32954609 CTGAGCCAGTGTCAGGAGGAAGG + Exonic
952686480 3:36155049-36155071 CTGTGGTTCTGGCAGGAGGAAGG + Intergenic
953880111 3:46687037-46687059 ATGGGCGAGTGGCTGGTGGAGGG + Exonic
955321627 3:57978707-57978729 CTGAGCTTGTGGCAGGTGCAGGG + Intergenic
955393337 3:58536901-58536923 CTGTGTTAGTAGCAGGGAGATGG - Intronic
956122206 3:65977704-65977726 ATTTGGTAGTGGCAGGAGGATGG - Intronic
956975292 3:74571997-74572019 TGGAGCCAGTGGCAGGTGGAGGG - Intergenic
957228476 3:77479428-77479450 CTGTTCTTGGGGCAAGTGGAGGG + Intronic
959817502 3:110692009-110692031 CTGTGGGAGAGTCAGGTGGAAGG + Intergenic
961024889 3:123546252-123546274 ATGTGCTATTGCCAAGTGGATGG + Intronic
961036078 3:123642521-123642543 CTGTGCCAGTGACAGCTGGAGGG + Intronic
964085524 3:152812899-152812921 CTATGCTGGTGGCAAGTGAAAGG - Intergenic
965812916 3:172610258-172610280 CTGTGCTTCTGGCAGGAAGAGGG + Intergenic
966200518 3:177356423-177356445 CTGAGCTAGGAGAAGGTGGAGGG + Intergenic
968679605 4:1908045-1908067 CTGTGCTAAGAGCAGGTGTAGGG + Intronic
969158714 4:5236244-5236266 CTGAGTGAGTGCCAGGTGGAAGG - Intronic
969391776 4:6896163-6896185 CTGTGCTAGTGTTAGGAGGTTGG + Intergenic
974387860 4:61226192-61226214 CTGTGCTAATGTCTGATGGAAGG - Intronic
979562957 4:122120609-122120631 CTGGGATAGAGGCATGTGGATGG + Intergenic
979647396 4:123087525-123087547 CTGTGCTTCTGGCAGGAGGAAGG - Intronic
980738151 4:136917625-136917647 CTGTGCTCTTGGCAGGGGGCAGG + Intergenic
980947530 4:139337275-139337297 ATGTGATAGTGGTAGGTGGTGGG + Intronic
980958246 4:139450125-139450147 CTATGCTAGTGGTTGGTGCAAGG - Intergenic
981430612 4:144654670-144654692 CTGTGCTGGGGGCAGGGGCAGGG - Intronic
981443201 4:144806601-144806623 TGGTGGTAGTGGCAGGTGGGTGG - Intergenic
984931470 4:184851262-184851284 CTGTGCTGGTGAAGGGTGGATGG + Intergenic
985646555 5:1087515-1087537 CAGTGCGTGTGGCATGTGGAAGG + Intronic
986393162 5:7303683-7303705 CTGTGAAAGTGCCAGGTTGAAGG + Intergenic
986674126 5:10168606-10168628 CTGTGCCAGTGGCAGGGGCGAGG - Intergenic
988967316 5:36432338-36432360 TTGGGATAGTGGGAGGTGGATGG + Intergenic
989479014 5:41906605-41906627 CTGGGCTAATGAGAGGTGGAAGG + Intronic
989779477 5:45247070-45247092 ATGTGCTGGTGGCAGCAGGACGG + Intergenic
990312328 5:54552023-54552045 CTGTGCTAGTTTCAGGAGAATGG + Intergenic
990415789 5:55585271-55585293 CTGTGCAAGAAGCAGGTGCAGGG + Intergenic
991936588 5:71808046-71808068 CTTTGTTAGTGGCTGGTGGCAGG + Intergenic
992863361 5:80934302-80934324 CTTTGCTAGAGGAAGGTTGATGG - Intergenic
996774492 5:127119303-127119325 CTGGGGTAGAGGCATGTGGATGG + Intergenic
996992655 5:129654412-129654434 CTGTGCAAATGGCAGGTGCCAGG + Exonic
997353006 5:133244256-133244278 CTGTGCTTGTGTCTGGTAGAAGG - Intronic
998400340 5:141845566-141845588 GGGTGCTAGTGGCAGCTGGGAGG + Intergenic
998414834 5:141938615-141938637 CTGTGCTCGAGGCATGTGGTAGG - Exonic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
1000777854 5:165442079-165442101 CTGTGCTAGGGCAATGTGGAAGG - Intergenic
1001071321 5:168587601-168587623 CTGGGCAAGTGGGTGGTGGATGG - Intergenic
1001181647 5:169526111-169526133 CTGTGCTAGGGCAATGTGGAAGG - Intergenic
1002105702 5:176878577-176878599 CTGTGGGTGTGGCAGGTGGAGGG + Exonic
1002467513 5:179415031-179415053 CTGCACTGGTGGCAGCTGGAGGG - Intergenic
1003238319 6:4318410-4318432 CTGTGCTAATCCCAGGTAGATGG + Intergenic
1003257467 6:4487130-4487152 CTGTGATTTTGGCAGGTTGAAGG - Intergenic
1003544131 6:7044181-7044203 AGGTGCTACTGGCAGGTGGCCGG - Intergenic
1003791721 6:9553619-9553641 CAGTGATAGTGGCAGGAGGTAGG - Intergenic
1005314228 6:24588653-24588675 CTGCGCTAGTGGGAGGTGTTGGG + Exonic
1006166773 6:32069978-32070000 CTGTGCTAGGGGCTTGTGCAGGG + Intronic
1006984039 6:38166157-38166179 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984047 6:38166185-38166207 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1006984135 6:38166462-38166484 CTGTGCGTGGGGGAGGTGGAGGG - Intergenic
1007315340 6:40983780-40983802 CTGGGATGGGGGCAGGTGGAAGG - Intergenic
1010373922 6:75144280-75144302 ATGGGATAGTGGCAGATGGAAGG - Intronic
1013317603 6:108957261-108957283 CTGTGTAAGGGGAAGGTGGAGGG - Intronic
1013564260 6:111341737-111341759 CTGTGCAAGTGGCAGGAGTTGGG + Intronic
1014553878 6:122821974-122821996 CTGTGCCAGTGGCAGATAGAGGG + Intergenic
1015036937 6:128667431-128667453 CTGTGGTAGTTGAAGGTAGAGGG + Intergenic
1015640126 6:135322861-135322883 CTGTGCATGAGGCAGGTGGCAGG + Intronic
1015937634 6:138418953-138418975 CTGGGGTAGAGGCATGTGGATGG + Exonic
1016851602 6:148624823-148624845 GGGTGCCAGGGGCAGGTGGAGGG + Intergenic
1017415828 6:154219573-154219595 CTGTGTAAGTGGGATGTGGAAGG - Intronic
1017778757 6:157700039-157700061 CTGAGATAAGGGCAGGTGGATGG + Intergenic
1018042825 6:159940296-159940318 CTCAGCTAGAGGAAGGTGGAGGG - Intergenic
1018373240 6:163187347-163187369 CTGTGCAAGTGGCCTGTGAAAGG + Intronic
1018966831 6:168496358-168496380 CTGTGCTAGTGGCTGCTGTCTGG - Intronic
1019554036 7:1619788-1619810 CTGTGCTGGGGGCAGGGAGATGG + Intergenic
1019941836 7:4298079-4298101 CTGAGCTGGTGGGAGGTGGCAGG + Intergenic
1020510494 7:9050211-9050233 CTGTAATAGTGGCAGGGGTAGGG - Intergenic
1023151777 7:37208193-37208215 CTGTGCTAGTCGCTGGTAGACGG + Intronic
1023929758 7:44698043-44698065 CTTTGCTGGTGGGAGGGGGAAGG + Intronic
1024231893 7:47369099-47369121 CTGCTCTTGTGGCAGGTGAAGGG + Exonic
1026864075 7:73811789-73811811 CTGTGCTAGTGGCAGGTGGAGGG - Intronic
1028508883 7:91599893-91599915 CTGTAGTAGTGACATGTGGAGGG - Intergenic
1029473632 7:100769902-100769924 CTGTTCTCCTGGCAGCTGGAGGG - Exonic
1031026720 7:116687032-116687054 CTGGGCGTGTTGCAGGTGGAAGG + Intronic
1032906272 7:136370977-136370999 CTGAGCTAGTGACAGAAGGATGG - Intergenic
1032991159 7:137396233-137396255 CTGTGTGAGTGGCAGGTGGAAGG + Intronic
1033666233 7:143443346-143443368 CTGCGCTTGGGGCAGCTGGAGGG + Intergenic
1033939594 7:146635934-146635956 CTGTTCCAGTGGCAAGTGAATGG + Intronic
1034858635 7:154577335-154577357 CTGTGCAGGTGGGAGCTGGAAGG + Intronic
1035251869 7:157603148-157603170 CAGTGATGGTGGCAGGTGGCGGG - Intronic
1036246909 8:7125755-7125777 CTTTGCTGGTGGCAGTTGGCTGG + Intergenic
1037952886 8:23030128-23030150 CTGTGCTCCTGGCAGGTGCTCGG - Intronic
1037963179 8:23115094-23115116 CTGTGCTCCTGGCAGGTGCTCGG + Intronic
1039778533 8:40760804-40760826 CTGTGCAACTTGCAGGTGCATGG - Intronic
1042722680 8:71842505-71842527 CTGTGATCGTGACAGGTGGCGGG - Exonic
1046190161 8:110784775-110784797 CTATGTTAGTGGAAGGTGAAGGG + Intergenic
1049462354 8:142735990-142736012 CGGGGCTAGAGGCAGATGGAAGG + Exonic
1049654271 8:143790886-143790908 CTGTGCTAGTGGGTGGGGGATGG + Intergenic
1049680514 8:143915924-143915946 CTGTGTGAGTGGCAGGTAGAAGG + Exonic
1052386702 9:27831258-27831280 CTGTGGGAGTGGCAGGGGGAGGG - Intergenic
1055947829 9:81707249-81707271 TGGTGGTGGTGGCAGGTGGAAGG + Intergenic
1056221209 9:84452148-84452170 CTGTCCTAGTGGCAGGTTGGTGG - Intergenic
1056536191 9:87529803-87529825 CTGTTCTAGGGGCAGGTGACAGG - Intronic
1056767203 9:89452123-89452145 GTGTGCCAGAGGCAGCTGGATGG + Intronic
1057232483 9:93332302-93332324 CTTTGCTTCTGGCAGGTGCAGGG - Intronic
1057252896 9:93518255-93518277 CTTTGCTTGTGGCAGGTGCAGGG + Intronic
1058626464 9:106938751-106938773 CTGTGGTTGTGGCAGGTTGTTGG + Intronic
1059041549 9:110820659-110820681 CTTTGCTGGGGGCAAGTGGAGGG + Intergenic
1061242991 9:129385047-129385069 CTGTGCTAATGGGAGGTGGCTGG + Intergenic
1061926653 9:133809178-133809200 ATGTGCAGGTGGCAGGTGGCCGG - Intronic
1062214160 9:135380041-135380063 CTGTGTCAGTGCCAGGTGGCAGG + Intergenic
1185719667 X:2371693-2371715 CTGTGATAATGGGAGGAGGAGGG - Intronic
1185719674 X:2371717-2371739 CTGTGATAATGGGAGGAGGAGGG - Intronic
1187128219 X:16474469-16474491 ATGTGGTAGATGCAGGTGGAGGG + Intergenic
1189411828 X:40779539-40779561 CTCTGCTTGTGGAAAGTGGAGGG - Intergenic
1195049190 X:101081176-101081198 CTGTGCTAGGGGCATCTAGAGGG + Intronic
1195195198 X:102490449-102490471 TTGTACTAGTGCCATGTGGAAGG - Intergenic
1195499647 X:105580309-105580331 TGGTGCTAGTGGGAGGAGGAAGG + Intronic
1196236223 X:113283858-113283880 CTGTTGTAGTGGCAGGTGTGGGG + Intergenic
1196283950 X:113857910-113857932 CTGTTGGAGTGGCAGGGGGAGGG - Intergenic
1196304706 X:114087444-114087466 CTCTGCATGTGGAAGGTGGAGGG + Intergenic
1198299163 X:135317650-135317672 CTGTGGTAGAGGCAGCTGGGTGG + Intronic
1198654491 X:138898805-138898827 CTGTGCAATTGGCAGTTTGAGGG + Intronic
1198821704 X:140655038-140655060 CTGTGCTAGTGCCAGGGATATGG - Intergenic
1200162290 X:154015788-154015810 CTGGGCTGGGGGCAGGGGGAAGG - Intronic
1202085897 Y:21136344-21136366 CTGTTCTAGAGTCAGGTGTAGGG + Intergenic