ID: 1026866380

View in Genome Browser
Species Human (GRCh38)
Location 7:73826572-73826594
Sequence CCCTGTCCCCAGAGTTCCAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026866380_1026866386 14 Left 1026866380 7:73826572-73826594 CCCCTGGAACTCTGGGGACAGGG No data
Right 1026866386 7:73826609-73826631 AGCTCCCACCTGTTATGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026866380 Original CRISPR CCCTGTCCCCAGAGTTCCAG GGG (reversed) Intronic