ID: 1026866386

View in Genome Browser
Species Human (GRCh38)
Location 7:73826609-73826631
Sequence AGCTCCCACCTGTTATGATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 62}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026866380_1026866386 14 Left 1026866380 7:73826572-73826594 CCCCTGGAACTCTGGGGACAGGG No data
Right 1026866386 7:73826609-73826631 AGCTCCCACCTGTTATGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 62
1026866384_1026866386 12 Left 1026866384 7:73826574-73826596 CCTGGAACTCTGGGGACAGGGGT 0: 1
1: 0
2: 2
3: 32
4: 386
Right 1026866386 7:73826609-73826631 AGCTCCCACCTGTTATGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 62
1026866378_1026866386 19 Left 1026866378 7:73826567-73826589 CCAAGCCCCTGGAACTCTGGGGA 0: 1
1: 0
2: 2
3: 32
4: 444
Right 1026866386 7:73826609-73826631 AGCTCCCACCTGTTATGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 62
1026866382_1026866386 13 Left 1026866382 7:73826573-73826595 CCCTGGAACTCTGGGGACAGGGG 0: 1
1: 1
2: 3
3: 43
4: 310
Right 1026866386 7:73826609-73826631 AGCTCCCACCTGTTATGATCAGG 0: 1
1: 0
2: 0
3: 6
4: 62

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026866386 Original CRISPR AGCTCCCACCTGTTATGATC AGG Intronic