ID: 1026870278

View in Genome Browser
Species Human (GRCh38)
Location 7:73846865-73846887
Sequence GCCCCTGTGCTGCTGACCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026870278_1026870286 7 Left 1026870278 7:73846865-73846887 CCAGTGGTCAGCAGCACAGGGGC No data
Right 1026870286 7:73846895-73846917 GGGGCCCACTGATCTCACAAGGG No data
1026870278_1026870289 13 Left 1026870278 7:73846865-73846887 CCAGTGGTCAGCAGCACAGGGGC No data
Right 1026870289 7:73846901-73846923 CACTGATCTCACAAGGGCCCTGG No data
1026870278_1026870285 6 Left 1026870278 7:73846865-73846887 CCAGTGGTCAGCAGCACAGGGGC No data
Right 1026870285 7:73846894-73846916 AGGGGCCCACTGATCTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026870278 Original CRISPR GCCCCTGTGCTGCTGACCAC TGG (reversed) Intergenic
No off target data available for this crispr