ID: 1026870289

View in Genome Browser
Species Human (GRCh38)
Location 7:73846901-73846923
Sequence CACTGATCTCACAAGGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026870278_1026870289 13 Left 1026870278 7:73846865-73846887 CCAGTGGTCAGCAGCACAGGGGC No data
Right 1026870289 7:73846901-73846923 CACTGATCTCACAAGGGCCCTGG No data
1026870283_1026870289 -9 Left 1026870283 7:73846887-73846909 CCAGGCCAGGGGCCCACTGATCT No data
Right 1026870289 7:73846901-73846923 CACTGATCTCACAAGGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026870289 Original CRISPR CACTGATCTCACAAGGGCCC TGG Intergenic
No off target data available for this crispr