ID: 1026873822

View in Genome Browser
Species Human (GRCh38)
Location 7:73868787-73868809
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026873808_1026873822 27 Left 1026873808 7:73868737-73868759 CCTTCCAAGGTCTCTGGCATCCT No data
Right 1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG No data
1026873817_1026873822 7 Left 1026873817 7:73868757-73868779 CCTGGGGGAAAGGGAGAAGGCCA No data
Right 1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG No data
1026873811_1026873822 23 Left 1026873811 7:73868741-73868763 CCAAGGTCTCTGGCATCCTGGGG No data
Right 1026873822 7:73868787-73868809 CCCTCGGCTGCCACTCACAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026873822 Original CRISPR CCCTCGGCTGCCACTCACAA TGG Intergenic