ID: 1026880106

View in Genome Browser
Species Human (GRCh38)
Location 7:73902371-73902393
Sequence ACCAGGAAGTTGGGGGTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026880100_1026880106 -7 Left 1026880100 7:73902355-73902377 CCAGCAGGGGCTCCGGACCAGGA No data
Right 1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG No data
1026880097_1026880106 -1 Left 1026880097 7:73902349-73902371 CCCTCTCCAGCAGGGGCTCCGGA No data
Right 1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG No data
1026880095_1026880106 5 Left 1026880095 7:73902343-73902365 CCATGTCCCTCTCCAGCAGGGGC No data
Right 1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG No data
1026880093_1026880106 6 Left 1026880093 7:73902342-73902364 CCCATGTCCCTCTCCAGCAGGGG No data
Right 1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG No data
1026880098_1026880106 -2 Left 1026880098 7:73902350-73902372 CCTCTCCAGCAGGGGCTCCGGAC No data
Right 1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026880106 Original CRISPR ACCAGGAAGTTGGGGGTCCC TGG Intergenic
No off target data available for this crispr