ID: 1026882573

View in Genome Browser
Species Human (GRCh38)
Location 7:73916860-73916882
Sequence GCTGCCAAACACGCAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026882573_1026882579 -2 Left 1026882573 7:73916860-73916882 CCAGCTTCTGCGTGTTTGGCAGC No data
Right 1026882579 7:73916881-73916903 GCTCAGGTGACTTGTGGTGGGGG No data
1026882573_1026882578 -3 Left 1026882573 7:73916860-73916882 CCAGCTTCTGCGTGTTTGGCAGC No data
Right 1026882578 7:73916880-73916902 AGCTCAGGTGACTTGTGGTGGGG No data
1026882573_1026882575 -8 Left 1026882573 7:73916860-73916882 CCAGCTTCTGCGTGTTTGGCAGC No data
Right 1026882575 7:73916875-73916897 TTGGCAGCTCAGGTGACTTGTGG No data
1026882573_1026882577 -4 Left 1026882573 7:73916860-73916882 CCAGCTTCTGCGTGTTTGGCAGC No data
Right 1026882577 7:73916879-73916901 CAGCTCAGGTGACTTGTGGTGGG No data
1026882573_1026882576 -5 Left 1026882573 7:73916860-73916882 CCAGCTTCTGCGTGTTTGGCAGC No data
Right 1026882576 7:73916878-73916900 GCAGCTCAGGTGACTTGTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026882573 Original CRISPR GCTGCCAAACACGCAGAAGC TGG (reversed) Intergenic
No off target data available for this crispr