ID: 1026887915

View in Genome Browser
Species Human (GRCh38)
Location 7:73965221-73965243
Sequence GAGGCTGCCCAGAGATTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026887908_1026887915 14 Left 1026887908 7:73965184-73965206 CCTGTGGGTTCAGCTTCACTCCA 0: 2
1: 0
2: 1
3: 13
4: 169
Right 1026887915 7:73965221-73965243 GAGGCTGCCCAGAGATTAGGAGG No data
1026887906_1026887915 29 Left 1026887906 7:73965169-73965191 CCTCTTGTTCTCTCACCTGTGGG 0: 2
1: 0
2: 1
3: 77
4: 490
Right 1026887915 7:73965221-73965243 GAGGCTGCCCAGAGATTAGGAGG No data
1026887912_1026887915 -6 Left 1026887912 7:73965204-73965226 CCAGGCTCAAAGACCAGGAGGCT No data
Right 1026887915 7:73965221-73965243 GAGGCTGCCCAGAGATTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026887915 Original CRISPR GAGGCTGCCCAGAGATTAGG AGG Intergenic
No off target data available for this crispr