ID: 1026889129

View in Genome Browser
Species Human (GRCh38)
Location 7:73971965-73971987
Sequence TTTCCAGGAGTCACCTCACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026889129_1026889133 17 Left 1026889129 7:73971965-73971987 CCAGGTGAGGTGACTCCTGGAAA No data
Right 1026889133 7:73972005-73972027 GTGCCCCTGCAGCCCAGGCCTGG No data
1026889129_1026889132 12 Left 1026889129 7:73971965-73971987 CCAGGTGAGGTGACTCCTGGAAA No data
Right 1026889132 7:73972000-73972022 CAGCAGTGCCCCTGCAGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026889129 Original CRISPR TTTCCAGGAGTCACCTCACC TGG (reversed) Intergenic
No off target data available for this crispr