ID: 1026890235

View in Genome Browser
Species Human (GRCh38)
Location 7:73977454-73977476
Sequence CTGGCTGAAGAAAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026890229_1026890235 -8 Left 1026890229 7:73977439-73977461 CCGGGCCCTCTGGGGCTGGCTGA No data
Right 1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG No data
1026890227_1026890235 -6 Left 1026890227 7:73977437-73977459 CCCCGGGCCCTCTGGGGCTGGCT No data
Right 1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG No data
1026890220_1026890235 20 Left 1026890220 7:73977411-73977433 CCTGGAATCTGCACACTGGAGAA No data
Right 1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG No data
1026890219_1026890235 21 Left 1026890219 7:73977410-73977432 CCCTGGAATCTGCACACTGGAGA No data
Right 1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG No data
1026890228_1026890235 -7 Left 1026890228 7:73977438-73977460 CCCGGGCCCTCTGGGGCTGGCTG No data
Right 1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG No data
1026890217_1026890235 26 Left 1026890217 7:73977405-73977427 CCAGTCCCTGGAATCTGCACACT No data
Right 1026890235 7:73977454-73977476 CTGGCTGAAGAAAGGGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026890235 Original CRISPR CTGGCTGAAGAAAGGGCAGG TGG Intergenic
No off target data available for this crispr