ID: 1026890657

View in Genome Browser
Species Human (GRCh38)
Location 7:73979889-73979911
Sequence GGTTTGTTATAGGTCCTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026890657_1026890666 24 Left 1026890657 7:73979889-73979911 CCCTGAAGGACCTATAACAAACC No data
Right 1026890666 7:73979936-73979958 GGCTCACTTGTAGAAATCCCAGG No data
1026890657_1026890665 3 Left 1026890657 7:73979889-73979911 CCCTGAAGGACCTATAACAAACC No data
Right 1026890665 7:73979915-73979937 AAGGTTGTATAGCAGGCGTGTGG No data
1026890657_1026890661 -4 Left 1026890657 7:73979889-73979911 CCCTGAAGGACCTATAACAAACC No data
Right 1026890661 7:73979908-73979930 AACCCCAAAGGTTGTATAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026890657 Original CRISPR GGTTTGTTATAGGTCCTTCA GGG (reversed) Intergenic
No off target data available for this crispr