ID: 1026895904

View in Genome Browser
Species Human (GRCh38)
Location 7:74010003-74010025
Sequence CTATGACACAGCCCATGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026895904_1026895910 5 Left 1026895904 7:74010003-74010025 CCAGGGCATGGGCTGTGTCATAG No data
Right 1026895910 7:74010031-74010053 GTGGCCACAGACAGCCTGTGTGG No data
1026895904_1026895912 9 Left 1026895904 7:74010003-74010025 CCAGGGCATGGGCTGTGTCATAG No data
Right 1026895912 7:74010035-74010057 CCACAGACAGCCTGTGTGGACGG No data
1026895904_1026895916 24 Left 1026895904 7:74010003-74010025 CCAGGGCATGGGCTGTGTCATAG No data
Right 1026895916 7:74010050-74010072 GTGGACGGGAACACAGCTGCGGG No data
1026895904_1026895913 10 Left 1026895904 7:74010003-74010025 CCAGGGCATGGGCTGTGTCATAG No data
Right 1026895913 7:74010036-74010058 CACAGACAGCCTGTGTGGACGGG No data
1026895904_1026895915 23 Left 1026895904 7:74010003-74010025 CCAGGGCATGGGCTGTGTCATAG No data
Right 1026895915 7:74010049-74010071 TGTGGACGGGAACACAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026895904 Original CRISPR CTATGACACAGCCCATGCCC TGG (reversed) Intergenic