ID: 1026895909

View in Genome Browser
Species Human (GRCh38)
Location 7:74010027-74010049
Sequence ACAGGCTGTCTGTGGCCACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026895909_1026895919 23 Left 1026895909 7:74010027-74010049 CCGGGTGGCCACAGACAGCCTGT No data
Right 1026895919 7:74010073-74010095 CCCACGACACAGCCACGCGGCGG No data
1026895909_1026895916 0 Left 1026895909 7:74010027-74010049 CCGGGTGGCCACAGACAGCCTGT No data
Right 1026895916 7:74010050-74010072 GTGGACGGGAACACAGCTGCGGG No data
1026895909_1026895917 20 Left 1026895909 7:74010027-74010049 CCGGGTGGCCACAGACAGCCTGT No data
Right 1026895917 7:74010070-74010092 GGGCCCACGACACAGCCACGCGG No data
1026895909_1026895915 -1 Left 1026895909 7:74010027-74010049 CCGGGTGGCCACAGACAGCCTGT No data
Right 1026895915 7:74010049-74010071 TGTGGACGGGAACACAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026895909 Original CRISPR ACAGGCTGTCTGTGGCCACC CGG (reversed) Intergenic