ID: 1026895915

View in Genome Browser
Species Human (GRCh38)
Location 7:74010049-74010071
Sequence TGTGGACGGGAACACAGCTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026895904_1026895915 23 Left 1026895904 7:74010003-74010025 CCAGGGCATGGGCTGTGTCATAG No data
Right 1026895915 7:74010049-74010071 TGTGGACGGGAACACAGCTGCGG No data
1026895911_1026895915 -9 Left 1026895911 7:74010035-74010057 CCACAGACAGCCTGTGTGGACGG No data
Right 1026895915 7:74010049-74010071 TGTGGACGGGAACACAGCTGCGG No data
1026895909_1026895915 -1 Left 1026895909 7:74010027-74010049 CCGGGTGGCCACAGACAGCCTGT No data
Right 1026895915 7:74010049-74010071 TGTGGACGGGAACACAGCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026895915 Original CRISPR TGTGGACGGGAACACAGCTG CGG Intergenic