ID: 1026895917

View in Genome Browser
Species Human (GRCh38)
Location 7:74010070-74010092
Sequence GGGCCCACGACACAGCCACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026895911_1026895917 12 Left 1026895911 7:74010035-74010057 CCACAGACAGCCTGTGTGGACGG No data
Right 1026895917 7:74010070-74010092 GGGCCCACGACACAGCCACGCGG No data
1026895914_1026895917 2 Left 1026895914 7:74010045-74010067 CCTGTGTGGACGGGAACACAGCT No data
Right 1026895917 7:74010070-74010092 GGGCCCACGACACAGCCACGCGG No data
1026895909_1026895917 20 Left 1026895909 7:74010027-74010049 CCGGGTGGCCACAGACAGCCTGT No data
Right 1026895917 7:74010070-74010092 GGGCCCACGACACAGCCACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026895917 Original CRISPR GGGCCCACGACACAGCCACG CGG Intergenic