ID: 1026899769

View in Genome Browser
Species Human (GRCh38)
Location 7:74030327-74030349
Sequence CAAGGAAGGAACCCTGTTGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 256
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 243}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026899762_1026899769 19 Left 1026899762 7:74030285-74030307 CCCTCAAGGAGGAGGGTGTCACT 0: 1
1: 0
2: 0
3: 14
4: 142
Right 1026899769 7:74030327-74030349 CAAGGAAGGAACCCTGTTGCGGG 0: 1
1: 0
2: 0
3: 12
4: 243
1026899763_1026899769 18 Left 1026899763 7:74030286-74030308 CCTCAAGGAGGAGGGTGTCACTT 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1026899769 7:74030327-74030349 CAAGGAAGGAACCCTGTTGCGGG 0: 1
1: 0
2: 0
3: 12
4: 243
1026899759_1026899769 29 Left 1026899759 7:74030275-74030297 CCTGGCTTCTCCCTCAAGGAGGA 0: 1
1: 0
2: 1
3: 30
4: 272
Right 1026899769 7:74030327-74030349 CAAGGAAGGAACCCTGTTGCGGG 0: 1
1: 0
2: 0
3: 12
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026899769 Original CRISPR CAAGGAAGGAACCCTGTTGC GGG Intronic
900395365 1:2451154-2451176 CCAGGAGGGAGGCCTGTTGCTGG + Intronic
903450739 1:23452180-23452202 CAGGGAGGGAACCCTCTTGGGGG + Intronic
903481210 1:23654686-23654708 CAAGGCAAGGACCCTGTTGAGGG + Intergenic
903775942 1:25793920-25793942 CAAGGAGGGAACCGTGCTGGGGG - Intergenic
904558402 1:31380574-31380596 AAAGGAAGGAGCCCATTTGCAGG + Intergenic
904817796 1:33219000-33219022 AAAGGAAGGAAGTCTCTTGCGGG - Intergenic
904972970 1:34433574-34433596 CAGGGAAGGAAGCCAGTTGCAGG + Intergenic
907222059 1:52914400-52914422 CCAGGAGAGAAGCCTGTTGCAGG + Intronic
907379909 1:54078377-54078399 CCAGGAAGGAACACTGCTCCAGG - Intronic
913283366 1:117206619-117206641 CAAGGAGCGAACCCTGGTGAGGG + Intronic
915380282 1:155433843-155433865 CAAAGCAGAAACCCTCTTGCAGG + Intronic
916358136 1:163936219-163936241 CAAGGAAGAAACCCTGTCCTTGG - Intergenic
919879226 1:201891305-201891327 CAAGGTAAGCACCCTGGTGCTGG - Intronic
921316858 1:213899999-213900021 GAAGGAAGAATCCCTGATGCTGG + Intergenic
921677334 1:217990877-217990899 CAAGGAGGGATCCCTGGTCCTGG - Intergenic
922785182 1:228279101-228279123 CCAGGAAGGAACCCTGCCGGAGG + Intronic
923667052 1:236007708-236007730 CAAAGAAGGATCCCTGCTGAAGG - Intronic
924611915 1:245580518-245580540 AAAGGAGGGAACCATGTTGGGGG + Intronic
1064652776 10:17526147-17526169 CATGGAAGGAACCCAGTGGGAGG + Intergenic
1068595263 10:58896270-58896292 CAAGGAAAGAATCCTGTGGAGGG - Intergenic
1073846856 10:107567193-107567215 CATGGGAGGAACCCTGTGGGAGG - Intergenic
1074226578 10:111489816-111489838 CAAGGAAGGGACCTTGTGGAAGG + Intergenic
1078145298 11:8718219-8718241 CAAGGAAAGACTCTTGTTGCTGG - Intronic
1079140499 11:17806160-17806182 CAAGGAACCATCCATGTTGCTGG - Intronic
1079916408 11:26373253-26373275 CGAGGGAGGAACCCTGTGGGAGG + Intronic
1081635315 11:44717667-44717689 GATGGAAGGAACCCTGGTGATGG - Intergenic
1084323991 11:68388563-68388585 CAAGGAGGGAACCCAGATCCTGG - Intronic
1085530957 11:77191714-77191736 CAGGGGAGGTACCGTGTTGCTGG + Intronic
1086166947 11:83790356-83790378 CAAGGAAAGAACCATCTGGCAGG + Intronic
1086196322 11:84144368-84144390 GAAGTAAGGAACCCTGTATCTGG - Intronic
1086491371 11:87360434-87360456 GGAGGAAGAACCCCTGTTGCAGG + Intergenic
1089878615 11:121751409-121751431 CCAGTAAGGAGCCCTGTTGCAGG + Intergenic
1091549500 12:1527348-1527370 GAAGAAAGTACCCCTGTTGCAGG - Intergenic
1091560815 12:1611602-1611624 CAAGGATGAGACCCTTTTGCAGG + Intronic
1091584809 12:1810162-1810184 CCAGGAGGGAACCCTGTTCGGGG - Intronic
1092046320 12:5433634-5433656 CTAGAAAGGATCCCTTTTGCTGG + Intronic
1093908636 12:24720906-24720928 CAAGGAATAAACCCTGCTGATGG + Intergenic
1095559367 12:43547513-43547535 CAAGGAAGGAACCCTCTGAAAGG + Intronic
1095923330 12:47553255-47553277 CAAGGAAGCAATCCTGATGCAGG - Intergenic
1099957836 12:89368594-89368616 CAAAGAACAAAGCCTGTTGCTGG + Intergenic
1100231621 12:92614395-92614417 CAAGTAAGGAACTCTGTTGAGGG + Intergenic
1100237288 12:92673480-92673502 CAAGGAAGGCAGCCTGCTGGGGG - Intergenic
1101333179 12:103773627-103773649 CAATCAAGGAACCCTGTGTCTGG + Exonic
1101674541 12:106906017-106906039 CAAAGATGGCACCCTCTTGCTGG + Intergenic
1101819888 12:108175552-108175574 CAGAGAAAGAACCCTGTGGCTGG + Intronic
1102594467 12:113981934-113981956 CAGGAAAGGAACCCAGATGCAGG + Intergenic
1104769547 12:131352518-131352540 CAAGGAAAGAACACTGGTCCTGG - Intergenic
1105757430 13:23481176-23481198 CAAGGAAGGGACCTTGTGGGAGG + Intergenic
1109642059 13:65203480-65203502 CATGGGAGGAACCCTGTGGGAGG + Intergenic
1109861606 13:68206437-68206459 CAAGCAAGGAAGCCTGTGGAGGG - Intergenic
1110713153 13:78672104-78672126 CAAAGAAGGAAACCTCTTTCTGG + Intergenic
1111318863 13:86597217-86597239 CAAGGAAGGGACCTGGTGGCAGG + Intergenic
1112511956 13:100017598-100017620 CAAGGAAGGGACCATGTTCTTGG - Intergenic
1112995788 13:105574120-105574142 CAAGGGAGAAACCCGGTAGCAGG + Intergenic
1113917635 13:113883959-113883981 CCAGGAAGAAACCCTGTGGAGGG - Intergenic
1115134665 14:30094498-30094520 CATGGAAGGGACCCAGTTGGAGG + Intronic
1118495958 14:66308425-66308447 CATGGGAGGAACCCTGTGGGAGG - Intergenic
1120628651 14:86860928-86860950 CAAGGAAGGAACTACGCTGCTGG + Intergenic
1122463624 14:101916286-101916308 CAAGGAAGGAACCCAGCTGAGGG + Intronic
1122858122 14:104569805-104569827 CAAGGCAGCATCCCTGTGGCTGG + Intronic
1126942703 15:53784029-53784051 CATGGAAGGAACCCAGTGGGAGG - Intergenic
1129426603 15:75467967-75467989 TAAGGAAGGGGCCCTGTGGCAGG + Exonic
1129492936 15:75947024-75947046 CAAGGAAGTAACCATGTTCTTGG + Intronic
1130051865 15:80490500-80490522 CACGGAAGAAAGCCTGTTGGTGG + Intronic
1130083991 15:80761988-80762010 CCAGGAAGCAGCCCTGGTGCAGG + Intergenic
1130834953 15:87640891-87640913 CAAGGGAGGAGCCATGTTGGGGG - Intergenic
1130881548 15:88060091-88060113 GAAGGAGGGCACCCTGTGGCTGG + Intronic
1130900097 15:88200480-88200502 CATGGAAGGGACCCTGTGGGAGG + Intronic
1131224121 15:90609831-90609853 CAACGCAGGAACCCTGATCCAGG - Intronic
1131328579 15:91473090-91473112 CAAGGAAGAGACCCTGTGGGAGG + Intergenic
1134395897 16:13863106-13863128 CAAGGGAGGGACCCAGTTGGAGG - Intergenic
1136710088 16:32229694-32229716 CATGGAAGGGACCCAGTTGGAGG + Intergenic
1136757821 16:32699717-32699739 CATGGAAGGGACCCAGTTGGAGG - Intergenic
1136810285 16:33170658-33170680 CATGGAAGGGACCCAGTTGGAGG + Intergenic
1136816761 16:33280738-33280760 CATGGAAGGGACCCAGTTGGAGG + Intronic
1137902791 16:52287168-52287190 CATGGAAGGGACCCTGTGGGAGG + Intergenic
1139098950 16:63742842-63742864 CAAAGAATGAACCCTAATGCAGG + Intergenic
1140607105 16:76552251-76552273 CAAGGGAGGGACCCTGTGGGAGG - Intronic
1141630521 16:85285354-85285376 TAAGGAGGTAACCCTGCTGCTGG - Intergenic
1203059971 16_KI270728v1_random:960066-960088 CATGGAAGGGACCCAGTTGGAGG - Intergenic
1142709734 17:1716394-1716416 CAAGGAGGCCACCCTTTTGCCGG + Intergenic
1145006775 17:19342823-19342845 CAAGGACAGAACCCTGTTATTGG - Intronic
1145022590 17:19443352-19443374 CAGGGAAGGAGCCCTGATGGAGG + Intergenic
1147999990 17:44382085-44382107 GAAGGAAGGAAACCTCTTCCAGG - Intronic
1148701763 17:49591617-49591639 CAGGGAAGGGACCCTGATGGGGG - Intergenic
1150884119 17:69065708-69065730 CAAGGAAGGCACCTTGTGGGAGG - Intergenic
1151085212 17:71372454-71372476 CAAGGAAGTAACCATGATGGGGG + Intergenic
1153695180 18:7633226-7633248 CAAGGAAAGAAACATATTGCTGG + Intronic
1153817861 18:8806710-8806732 AAAGAAAGGGTCCCTGTTGCTGG - Intronic
1157212392 18:45754743-45754765 CAAGGATGGCATCCTGTTTCTGG - Intergenic
1158144261 18:54293429-54293451 CTAGGAAGGAAACCTCTTCCTGG + Intronic
1158858888 18:61572521-61572543 CAAGGAAGTAACCATGTTCTTGG - Intergenic
1163302266 19:16455459-16455481 CGAGGCAGGAAGCCTGCTGCAGG - Intronic
1164347258 19:27281740-27281762 TAAGGAAGGAATCCAGTTTCAGG + Intergenic
1164348217 19:27295467-27295489 TAAGGAAGGAATCCAGTTTCAGG + Intergenic
1165019178 19:32909009-32909031 CATGGAAGGAACAATGATGCGGG + Intronic
925522840 2:4766914-4766936 CAATGAAGCAACCATGTAGCAGG - Intergenic
926312240 2:11683083-11683105 CAGGGAAGGGACCTTGTTGAAGG - Intronic
927213042 2:20650516-20650538 CAGGGCAGGAACCCGGTTTCTGG - Intronic
930892304 2:56404563-56404585 CATGGGAGGAACCCACTTGCAGG + Intergenic
932836802 2:75045747-75045769 CAAGACAGGAAACCTGTGGCAGG - Intergenic
936499738 2:113056770-113056792 CATGGAAGGAACCCAGTGGGAGG - Intergenic
938188514 2:129254472-129254494 CAAGGAAGGGGCCCTGGGGCTGG - Intergenic
938544375 2:132314562-132314584 CATGGGAGGAACCCTGTAGGAGG - Intergenic
939546902 2:143565904-143565926 CACACAAGGATCCCTGTTGCTGG + Intronic
939611178 2:144312686-144312708 CAAGGGAGGAACCCAGTGGGAGG + Intronic
939635055 2:144571699-144571721 CAAGGAGAGAACCGTGGTGCTGG - Intergenic
940876254 2:158900529-158900551 CAAGGAAGAAGTCCTGCTGCAGG - Intergenic
941225213 2:162839251-162839273 CAGGGACGGAGCCCTGTGGCCGG - Intergenic
943320351 2:186436408-186436430 CAGGGAAGGAACCCTCCTCCAGG + Intergenic
944392299 2:199229639-199229661 GGAGGAAGAACCCCTGTTGCAGG - Intergenic
944965326 2:204925797-204925819 CAAGGGAGGAACCCAGTGGATGG + Intronic
945826923 2:214732247-214732269 CAAGAAAGGAGCCCTTTTGCAGG - Intronic
946529508 2:220556767-220556789 CAAGGAATGAACCTAGATGCTGG + Intergenic
948332395 2:237180025-237180047 GAAGGAAGGAAGCCTGCTGGAGG + Intergenic
1172111435 20:32547656-32547678 CAAGGAAGCACCCAAGTTGCAGG + Intronic
1172298172 20:33828615-33828637 CATGGAGGAAACCCTGATGCAGG - Intronic
1172920955 20:38481581-38481603 CATGGGAGGAACCCTGTGGGAGG - Intronic
1173068194 20:39735281-39735303 CAAGGAGAGAAGCCTGTAGCAGG + Intergenic
1173564150 20:44027404-44027426 CAAGGCAGGAAGCCTGGTGGTGG - Intronic
1175328160 20:58143933-58143955 GAAGAAAGGAAGCCTGCTGCTGG - Intergenic
1176034485 20:63029537-63029559 CAGGGAAGGAAGCCTTTTGGGGG - Intergenic
1177016026 21:15788261-15788283 CAGGGGAGGAACCCTTATGCAGG + Intronic
1177906028 21:26972305-26972327 CCAGGAAGGAACCCTCTTCCAGG + Intergenic
1178222058 21:30671209-30671231 CATGGGAGGAACCCTGTGGGAGG - Intergenic
1178367334 21:31998686-31998708 CAAGGAAGACCCCCTGATGCTGG + Exonic
1179807648 21:43850075-43850097 CAAGGAAGGAAGGGTGTGGCAGG + Intergenic
1181802716 22:25358019-25358041 CAAGGAGGGAACCCAGATCCTGG + Intronic
1182621915 22:31623109-31623131 CAAGGAGGAAACCCTGTTCCTGG - Intronic
1183330904 22:37220883-37220905 CAAGGGAGGAACCCAGTGGGAGG - Intergenic
1184875267 22:47270384-47270406 AAAGAAAGGAATCCTGTTACCGG - Intergenic
1185415551 22:50707508-50707530 CATAGAAGGAACCCTTTTCCTGG + Intergenic
951188024 3:19736386-19736408 CAAGGAAGGAACACAGCTGGGGG + Intergenic
952066636 3:29578641-29578663 CATGGATGGAACCCTGTCCCAGG + Intronic
953845500 3:46423074-46423096 GGAGGAAGAACCCCTGTTGCGGG - Intergenic
954109391 3:48425578-48425600 CTAGGAAGGAGCCCCGTGGCTGG + Intronic
954934063 3:54310875-54310897 CAAGGAAAGGACCCTGGTGGAGG + Intronic
957172120 3:76751259-76751281 CAAGGAAGGGATCCAGTTTCAGG - Intronic
957502298 3:81072783-81072805 CATGGGAGGAACCCTGTGGGAGG - Intergenic
957997804 3:87712253-87712275 CAAGGGAGGAACCCAGTGGGAGG - Intergenic
958688703 3:97432875-97432897 CAAGGAAGAAACCCAGTGGGAGG - Intronic
959162777 3:102740442-102740464 CAAGGAAGGAACCCTCCTCTGGG + Intergenic
962311709 3:134331510-134331532 CAGGGATGGAACTCTGCTGCAGG - Intergenic
962671347 3:137711957-137711979 CATGGGAGGAACCCTGTGGGAGG - Intergenic
963306547 3:143659846-143659868 CATGGAAGGGACCCTGTGGGAGG + Intronic
966120426 3:176513794-176513816 CAAGGAAGGAAAACAGTTGGGGG - Intergenic
968645012 4:1736036-1736058 CAAGGCAGCAGCCCTGTGGCTGG - Intronic
969996298 4:11316605-11316627 CAAGGGAGGAACCCAGTAGGAGG - Intergenic
972645163 4:40961003-40961025 CAAGGCAGCATCTCTGTTGCAGG - Intronic
975202657 4:71609636-71609658 CAATGAAGCAACTCTCTTGCTGG + Intergenic
975942000 4:79659372-79659394 CATGGAAGGAACCCAGTGGGAGG + Intergenic
976811958 4:89108077-89108099 CAAGGAAGGAATCCTCCTCCAGG + Intronic
977017929 4:91717356-91717378 AAAGGAACCAACCCTGTTTCTGG - Intergenic
979850990 4:125571169-125571191 TAAGGAAGGGACCCAGTTTCAGG - Intergenic
980085293 4:128384215-128384237 GAAGGAGGGAACCCTGGGGCTGG + Intergenic
980631326 4:135438812-135438834 CATGGGAGGAACCCAGTTGGAGG - Intergenic
981330342 4:143501085-143501107 CAAGGGAGGAACCCGGTAGGAGG + Intergenic
982550055 4:156786544-156786566 CAAGGAGGGGACGCTGTGGCTGG + Intronic
983981712 4:174005685-174005707 CAAGATAGGAACTCAGTTGCAGG - Intergenic
984022348 4:174501150-174501172 AATGGGAGGACCCCTGTTGCAGG + Intronic
984317073 4:178141435-178141457 CAGGGAAGGAACCCTTCTCCAGG + Intergenic
984944365 4:184959700-184959722 CATGGAGGGAAGCCTGCTGCGGG - Intergenic
985028151 4:185759776-185759798 TAACTAAGGAACCCTGTTACAGG - Intronic
985070946 4:186166188-186166210 CACAGAAGGACCCCTGTTGTAGG + Intronic
985756364 5:1721014-1721036 CAAGGAAAGAAGCATGTCGCGGG + Intergenic
986121902 5:4847146-4847168 CAAAGAAGGAGCCTTTTTGCTGG + Intergenic
986324376 5:6661009-6661031 CAAGGAAGGGACCCAGTGGGAGG - Intronic
986493967 5:8323002-8323024 CCAAGAAGGATCCTTGTTGCTGG + Intergenic
986878792 5:12144173-12144195 CATGGAAGGAACCTGGTGGCAGG + Intergenic
988056022 5:26098103-26098125 CAAGGAAGGAAAACAGTGGCTGG + Intergenic
988149824 5:27363562-27363584 CATGGAAGGAACCCAGTGGGAGG + Intergenic
988679913 5:33474888-33474910 CATGGGAGGAACCCTGTGGGAGG - Intergenic
989169621 5:38461536-38461558 CAAGCAAGGCAAGCTGTTGCGGG + Intronic
990168250 5:53018442-53018464 CCAGGAAGGATTCCTGGTGCTGG + Intronic
992324736 5:75649575-75649597 CAAAGCAGGAACCCTGTAGTAGG - Intronic
992499012 5:77323277-77323299 CCTGGAAGGAACTCTGTGGCTGG + Intronic
993594528 5:89835901-89835923 GGAGGAAGGAACCCTGTGGGAGG + Intergenic
995371302 5:111421809-111421831 CATGGGAGGGACCCTGTTGGAGG + Intronic
995619780 5:114011842-114011864 TAAGGAAGGAACCCGGTGGGAGG - Intergenic
996826591 5:127688970-127688992 TAAGGAAGGCTCTCTGTTGCTGG - Intergenic
997100174 5:130959476-130959498 CAAGGGAGGAACCCGGTGGGAGG + Intergenic
997348431 5:133210907-133210929 GAACGAAGGAACCCTGGAGCTGG - Intronic
998557152 5:143136605-143136627 CATGGAAGGCACCCTGTGGGGGG + Intronic
999231348 5:150063870-150063892 CAGGGAAGGAGCCCAGCTGCAGG - Intronic
999330217 5:150668707-150668729 CAACAAAGGAAGCCTTTTGCAGG - Intronic
1000410793 5:160933864-160933886 CAGGGAAGGAACCCTTCTCCAGG - Intergenic
1002452535 5:179327047-179327069 CAAGGATGGAACCCTCTAGAAGG - Intronic
1002630050 5:180567193-180567215 CAAGAAAGGAAACATGTTGATGG + Exonic
1002948433 6:1784776-1784798 AAAGGAAGGAAGCTTGCTGCTGG - Intronic
1003140930 6:3470722-3470744 CCAGGAAGGAACCCTCATCCGGG + Intergenic
1003532694 6:6951382-6951404 CAAGGAAGCAATCCTGATGAAGG - Intergenic
1007214586 6:40227534-40227556 CCCAGAAGGAACCCTGCTGCAGG - Intergenic
1010147808 6:72692382-72692404 CATGGAAGGAATGCTGCTGCAGG - Intronic
1010474161 6:76265437-76265459 TAAGGAAGAAACACTGTGGCAGG - Intergenic
1012569212 6:100701082-100701104 CATGGGAGGAACCCGGTTGGAGG + Intronic
1012605523 6:101153435-101153457 TAAGGAAGGGACCCAGTTTCAGG + Intergenic
1014752154 6:125268515-125268537 GGAGGAAGGACCCCTGTTGTGGG + Intronic
1014896757 6:126910719-126910741 CATGGAAGGAACCCTGTGGGAGG + Intergenic
1015592530 6:134836072-134836094 CCAGGAAGGAATGCTGTTGGAGG + Intergenic
1015675115 6:135737242-135737264 CATGGAAGGAACCCGGTGGGAGG - Intergenic
1015895135 6:138009782-138009804 ACAGGAAGGATCTCTGTTGCCGG + Intergenic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1017032169 6:150233874-150233896 AAAGGAAGGCACCCCATTGCAGG + Intronic
1017326874 6:153150600-153150622 GAAGGAAGAAACCCCGTTGCAGG + Intergenic
1018071421 6:160167525-160167547 CATGGGAGGAACCCAGTTGGAGG + Intergenic
1018889267 6:167970907-167970929 CAAGGAAGGAATTCAGTTACAGG + Intronic
1018961068 6:168448792-168448814 CAAGGATGGAAACGTGTTGTTGG + Intronic
1023541362 7:41270196-41270218 CAAGGAGGCAAGCCTGTTCCAGG + Intergenic
1024308926 7:47951289-47951311 CAAGGACGGAACCCCCTGGCTGG + Intronic
1026803135 7:73412342-73412364 CATGGAAGAAACCATGTGGCCGG - Intergenic
1026899769 7:74030327-74030349 CAAGGAAGGAACCCTGTTGCGGG + Intronic
1026971852 7:74473286-74473308 CAAGGGAGGAACCCAGTCTCAGG + Intronic
1027053343 7:75033194-75033216 CCGGGAAGGACCCCTGGTGCAGG - Intronic
1027419447 7:78005274-78005296 CATGGGAGGAACCCTGTGGGAGG + Intergenic
1027875667 7:83764565-83764587 CATGGAAGGGACCCAGTGGCAGG - Intergenic
1028884255 7:95913423-95913445 CATGGATGGGACCCTGTTGGAGG + Intronic
1030904426 7:115164239-115164261 CATGGAAGGAACCCAGTGGGAGG - Intergenic
1031286097 7:119869788-119869810 CAAGGGAGGAACCCTATGGGAGG + Intergenic
1031515071 7:122690376-122690398 CAGGGAAGGAACCCTCCTCCGGG - Intronic
1032559292 7:132872013-132872035 CTAGGAAGGAATGCTGTGGCAGG + Intronic
1033012877 7:137641020-137641042 CATGGGAGGAACCCGGTGGCAGG + Intronic
1035310579 7:157965357-157965379 CAAGCCAGGAACCCTGGTGAGGG - Intronic
1035590168 8:806592-806614 CGAGCAAGGAAGCCTGTTCCGGG - Intergenic
1037003513 8:13748819-13748841 CATGGGAGGAACCCAGTTGGAGG - Intergenic
1038269851 8:26066230-26066252 CAAGGGAGGAACCTTGTGGGAGG + Intergenic
1039378095 8:37057663-37057685 CAAGGGAGGGACCCTGTGGGAGG + Intergenic
1039542679 8:38384218-38384240 CAAGGGAGAAACCCAGGTGCCGG - Intergenic
1040581703 8:48703963-48703985 CAAGGACTGAAGCCTGTTGCAGG + Intergenic
1041026366 8:53690837-53690859 CCAGGATGGAGCCTTGTTGCCGG - Intergenic
1041033786 8:53766110-53766132 CAAAGAGTGAATCCTGTTGCGGG + Intronic
1042503878 8:69539021-69539043 CCAGGATTGAACCCTGTAGCTGG + Intronic
1045910576 8:107403277-107403299 CAAGGAGGAAAGCCTGTTCCTGG + Intronic
1048214090 8:132480325-132480347 CAAAGACGGGACCCTGCTGCTGG - Exonic
1049818919 8:144622367-144622389 CACAGAAGGAAGCCTGTGGCGGG - Intergenic
1050191299 9:3029388-3029410 GAGGGAAGGAAGCCTGTTTCTGG + Intergenic
1050660154 9:7875717-7875739 TAAGGGAGGAACCCTGTGGGAGG + Intronic
1050727052 9:8662403-8662425 CAAGGAAGCATCTCTGCTGCTGG + Intronic
1052210312 9:25895315-25895337 CATGGGAGGAACCCTGTGGGAGG - Intergenic
1055329681 9:75170961-75170983 CAGGGAAGAAAGCCTGTTGGTGG - Intergenic
1055336358 9:75236890-75236912 CAGGGAAGGAACCCTCCTCCGGG - Intergenic
1057638572 9:96795469-96795491 CATGGGAGGAACCCAGTTGGAGG - Intergenic
1058571034 9:106344545-106344567 CAAGCCAGGAATCCTGTTACTGG + Intergenic
1058627924 9:106954414-106954436 CAAGGAAGGGACCTTGTGGGAGG - Intronic
1058897945 9:109416212-109416234 CAAGGCAGGAACCTTGATGCTGG + Intronic
1060851153 9:126877596-126877618 ACAGGAAGGAAACCTGTTGTAGG + Intronic
1187009438 X:15265077-15265099 CAAGGATGGAACCCTGGGACAGG - Intronic
1188873005 X:35397733-35397755 CATGGAAGGGACCCTGTGGGAGG - Intergenic
1189408142 X:40744289-40744311 CCAGGGAGGAACCCAGTTGGGGG - Intergenic
1193459608 X:81775088-81775110 CATGGGAGGAACCCAGTTGGAGG - Intergenic
1193644669 X:84052985-84053007 CATGGGAGGAACCCAGTTGGAGG + Intergenic
1195629771 X:107042881-107042903 CATGGAAGGGACCCTGTGGGAGG - Intergenic
1196412425 X:115434080-115434102 CAAGGAAGGAGCTCTGTGGTAGG + Intergenic
1197138905 X:123094993-123095015 AGAAGAAGGAACCATGTTGCAGG - Intergenic
1198020455 X:132652105-132652127 CAAGGAAGCAAGCCTTTTGGAGG + Intronic
1199171966 X:144743265-144743287 CAAGGAGGGTGCCCCGTTGCTGG - Intergenic
1201273465 Y:12277886-12277908 CAAGGAAGAATGCCTGTTCCTGG - Intergenic