ID: 1026902588

View in Genome Browser
Species Human (GRCh38)
Location 7:74045260-74045282
Sequence GGCTTAACTCCTGCTCCAGT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 94}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026902588_1026902597 12 Left 1026902588 7:74045260-74045282 CCCACTGGAGCAGGAGTTAAGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1026902597 7:74045295-74045317 TATGCAGCTGTCTGGACAGAGGG 0: 1
1: 0
2: 1
3: 15
4: 170
1026902588_1026902598 19 Left 1026902588 7:74045260-74045282 CCCACTGGAGCAGGAGTTAAGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1026902598 7:74045302-74045324 CTGTCTGGACAGAGGGCTGATGG 0: 1
1: 1
2: 0
3: 28
4: 275
1026902588_1026902599 23 Left 1026902588 7:74045260-74045282 CCCACTGGAGCAGGAGTTAAGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1026902599 7:74045306-74045328 CTGGACAGAGGGCTGATGGCAGG 0: 1
1: 0
2: 2
3: 76
4: 1041
1026902588_1026902596 11 Left 1026902588 7:74045260-74045282 CCCACTGGAGCAGGAGTTAAGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1026902596 7:74045294-74045316 GTATGCAGCTGTCTGGACAGAGG 0: 1
1: 0
2: 1
3: 19
4: 151
1026902588_1026902594 4 Left 1026902588 7:74045260-74045282 CCCACTGGAGCAGGAGTTAAGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1026902594 7:74045287-74045309 GCTCCAGGTATGCAGCTGTCTGG 0: 1
1: 0
2: 1
3: 20
4: 201
1026902588_1026902600 24 Left 1026902588 7:74045260-74045282 CCCACTGGAGCAGGAGTTAAGCC 0: 1
1: 0
2: 0
3: 5
4: 94
Right 1026902600 7:74045307-74045329 TGGACAGAGGGCTGATGGCAGGG 0: 1
1: 0
2: 3
3: 81
4: 1069

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026902588 Original CRISPR GGCTTAACTCCTGCTCCAGT GGG (reversed) Exonic
905204069 1:36332880-36332902 TGCATAACTCCTGCTTTAGTTGG - Intergenic
905389321 1:37626128-37626150 GGCCTGACTCCAGCTACAGTGGG - Intronic
906644736 1:47466231-47466253 TGCTTACCTCCTGACCCAGTGGG + Intergenic
907174932 1:52511302-52511324 GACTTAATTCATTCTCCAGTAGG - Intronic
907329537 1:53662052-53662074 GGCTGAACTGCTGCTACAGAAGG + Intronic
908508828 1:64833951-64833973 GGCTTAGCTCCTGTTCCTTTGGG - Exonic
909004303 1:70256959-70256981 GGCTTATCTGCTGCTCCTTTGGG - Intergenic
914347903 1:146815549-146815571 GGCTTTATTCCTACTGCAGTGGG - Intergenic
915196152 1:154191451-154191473 GGCATAACTCCTGAGGCAGTGGG - Intronic
916554862 1:165885612-165885634 AGCTGAACTCACGCTCCAGTGGG + Intronic
917950841 1:180033989-180034011 GGCTTAAATCCTGTTATAGTTGG - Exonic
920364566 1:205441203-205441225 GGCTTGACTCCTCCCCCAGCCGG - Intronic
1064175737 10:13073452-13073474 GTGGTTACTCCTGCTCCAGTTGG - Intronic
1067008326 10:42686650-42686672 GAATAAACTTCTGCTCCAGTAGG - Intergenic
1069718859 10:70537726-70537748 GGCTTAACTCCTGCCCTTGCAGG + Intronic
1070056452 10:72939721-72939743 CTCTTGACTCCTGCTTCAGTGGG - Intronic
1070379924 10:75871495-75871517 GGCATGACTCCTCCTCCAGTAGG - Intronic
1073458388 10:103651391-103651413 GGCCTTTCTCCTGCCCCAGTGGG + Intronic
1074277294 10:112015764-112015786 GGCATAACTCCTGCACCAAAAGG - Intergenic
1076058508 10:127394927-127394949 GGCATCACTCCTGCACCTGTGGG - Intronic
1076249969 10:128977855-128977877 AGCTCACCTCCTGCTCCAGCGGG - Intergenic
1088679320 11:112226002-112226024 GGCTCAATTCCTGCTCCTTTTGG + Intergenic
1093804369 12:23414055-23414077 GGCATAACCCCAGATCCAGTTGG - Intergenic
1094083146 12:26559705-26559727 CACTAAACTCCTGCCCCAGTGGG + Intronic
1094494265 12:30979655-30979677 GGCTTACATCCTGCTGGAGTCGG - Exonic
1097262912 12:57729554-57729576 GGCCTAACTCCTGCAGCAGGAGG - Intronic
1098417765 12:70255178-70255200 ATCTTAACTCCTGCTTCATTAGG + Intronic
1111041749 13:82757664-82757686 GGATCAACTCCTACTCCAGGGGG - Intergenic
1113957429 13:114106718-114106740 GGCTTAACACCTGAACCAGCTGG + Intronic
1114616207 14:24069638-24069660 GGCTTATCTCCTCCCCCAGGAGG + Exonic
1120266796 14:82260991-82261013 GGCCTGATTACTGCTCCAGTTGG - Intergenic
1121224386 14:92310581-92310603 GTCTTTTGTCCTGCTCCAGTGGG + Intergenic
1121812853 14:96906875-96906897 GGGCTCACTCCTGCTCAAGTTGG - Intronic
1124368851 15:29091895-29091917 GGCTCCCCTCCTGCTCCAGCTGG - Intronic
1129937501 15:79463129-79463151 GGCTGAACACCTGCTCCACCAGG - Exonic
1134829551 16:17312179-17312201 GGCTTCACGCCTGCTTCATTTGG - Intronic
1134847566 16:17453304-17453326 GGCTTTACTCCTGGTAAAGTGGG + Intronic
1136085268 16:27880471-27880493 GGATTAAACCCAGCTCCAGTTGG - Intronic
1138210620 16:55160019-55160041 GCCACAACTCCTGCTCCAGCAGG - Intergenic
1139576107 16:67843092-67843114 GGCTTCACGTCTTCTCCAGTGGG - Exonic
1139986132 16:70899983-70900005 GGCTTTATTCCTACTGCAGTGGG + Intronic
1144591508 17:16528123-16528145 CACTAAAATCCTGCTCCAGTGGG + Intergenic
1153500117 18:5740657-5740679 GGGTTAACTTCCTCTCCAGTTGG - Intergenic
1157283484 18:46361213-46361235 GGCTTCACCCCAGCTCCAGATGG + Intronic
1157975220 18:52319426-52319448 GAGTTAACTCAGGCTCCAGTGGG - Intergenic
1161624848 19:5320281-5320303 GGTTTAATCCCTGCCCCAGTGGG + Intronic
1164893207 19:31842880-31842902 GGCTTCACTGCTGCTGCTGTTGG - Intergenic
1166668592 19:44696449-44696471 GGCTCCACTCTTGCTCCTGTTGG - Intergenic
926923517 2:17963108-17963130 TGCCTATCTCCTGCTCCATTCGG - Intronic
929858824 2:45657921-45657943 TGCTTAACTCAGGCTCCATTCGG - Intronic
931105609 2:59052052-59052074 GGCAGGACTGCTGCTCCAGTTGG - Intergenic
931603303 2:64025969-64025991 TGGTTGACTCCTGCTCCAGCAGG - Intergenic
935466194 2:103400954-103400976 GGCTTCACCCCCGCTTCAGTAGG - Intergenic
943998413 2:194801261-194801283 GCTTTATCTGCTGCTCCAGTAGG + Intergenic
945757507 2:213866777-213866799 AGCTTAATTACTTCTCCAGTTGG + Intronic
946531022 2:220570462-220570484 GGGTTCACTCTTGCTCCATTTGG + Intergenic
1173521123 20:43701128-43701150 GGTTTAACTCCTGTTCCTGGAGG - Intronic
1176428626 21:6563286-6563308 GGCTGACCTCCTCCTCCACTGGG - Intergenic
1179077250 21:38134348-38134370 TACTTCACTCCTGCTCCAGGAGG - Intronic
1179093566 21:38291138-38291160 GGCTCAGCTTCAGCTCCAGTAGG + Intronic
1179704116 21:43171602-43171624 GGCTGACCTCCTCCTCCACTGGG - Intronic
949926361 3:9045468-9045490 GGCATAACTCCTGGTCCATTTGG - Intronic
951046043 3:18039642-18039664 TGCTAAACTCCTGGTACAGTGGG + Intronic
953336909 3:42101230-42101252 GGCATAACTCCATGTCCAGTGGG - Intronic
956645775 3:71454379-71454401 GCCTTAGCTCCTGCTTCAGTGGG - Intronic
963431908 3:145217502-145217524 GACTTAACTTCTGAACCAGTTGG - Intergenic
964518930 3:157543060-157543082 ACCTTAAATCCTGCTCCAGGCGG + Intergenic
964833081 3:160907811-160907833 GGCTGCATTCCTGCTCCAGCTGG - Intronic
966193911 3:177295314-177295336 GTCTCAACTCCTCCTCCAGGAGG + Intergenic
967947727 3:194817589-194817611 GGCCTTACTCCAGCTCCAGGTGG + Intergenic
975131103 4:70833931-70833953 GGATTTACTCCTGCTCCACAAGG + Intronic
981046141 4:140267111-140267133 AGCTGAACTCCAGCTCTAGTGGG - Intronic
985571123 5:645874-645896 AGCGTCACTCCTGCTCCCGTCGG + Intronic
985571132 5:645939-645961 AGCGTCACTCCTGCTCCCGTTGG + Intronic
993853103 5:93035696-93035718 GGCTTCTCTCCTTTTCCAGTTGG + Intergenic
999134332 5:149307769-149307791 TGTTTAAATTCTGCTCCAGTGGG - Intronic
1001245109 5:170100371-170100393 GACCTTACTCCTGCTGCAGTGGG - Intergenic
1006623407 6:35383176-35383198 GGCTGAACTCCAGCACCAGTGGG - Intronic
1014493246 6:122088817-122088839 TCCTCATCTCCTGCTCCAGTGGG + Intergenic
1018714521 6:166521376-166521398 GGCAGGACCCCTGCTCCAGTGGG + Intronic
1023806758 7:43877926-43877948 GGCAGAACTCCTTCTCCACTTGG + Exonic
1026393485 7:69927702-69927724 GGCTTAACGGCTGCTGCAGTGGG + Intronic
1026902588 7:74045260-74045282 GGCTTAACTCCTGCTCCAGTGGG - Exonic
1030902184 7:115138364-115138386 AGCTGAAATCCTGCTACAGTGGG - Intergenic
1035420313 7:158724252-158724274 GTCTCAACTCCTGGTCCAGAGGG - Intergenic
1036018305 8:4812008-4812030 GGCTTGACTCCTGCTGTAATTGG - Intronic
1041642683 8:60219688-60219710 TGCTTAACTCCTGCCCCTTTTGG - Intronic
1048635056 8:136286435-136286457 GGCTAAACCCCTGACCCAGTGGG + Intergenic
1049393041 8:142381808-142381830 GGCTTGTCTTCTGCTCCATTAGG - Intronic
1049475582 8:142795628-142795650 CGCTGGACTCCTGCTCCAGAAGG - Intergenic
1049544151 8:143221722-143221744 GGCCTAACCCCTGCCCCAGGTGG - Intergenic
1053356731 9:37452338-37452360 GGTTTAACTCATGCTGCATTTGG - Intronic
1060000783 9:119956915-119956937 GGTTTTACTCCTGCCCCAGCAGG + Intergenic
1060798951 9:126531743-126531765 GGCTTAGCCCCTGCTCCACACGG + Intergenic
1061608258 9:131728109-131728131 TCCTTAACCCCTGCTCCACTGGG - Intronic
1062005916 9:134238365-134238387 GGCTCAAGGCCGGCTCCAGTGGG - Intergenic
1062199671 9:135295430-135295452 GGCACAAGTCCTGGTCCAGTTGG - Intergenic
1185872017 X:3672611-3672633 GGCTGCTCTCCTGCTCCAGGAGG + Intronic
1192273408 X:69605765-69605787 GTCTCAACTCCTGCTTCTGTGGG + Intergenic
1197463911 X:126780255-126780277 GTCTCTACTCCTGCTCAAGTTGG + Intergenic