ID: 1026904144

View in Genome Browser
Species Human (GRCh38)
Location 7:74053237-74053259
Sequence GCTCCTGGGACACCAACACC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 175}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026904144_1026904156 21 Left 1026904144 7:74053237-74053259 CCAGGTGTTGGTGTCCCAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1026904156 7:74053281-74053303 TGCTGGGATCCCAGGTGCTGCGG 0: 1
1: 0
2: 5
3: 54
4: 536
1026904144_1026904150 4 Left 1026904144 7:74053237-74053259 CCAGGTGTTGGTGTCCCAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1026904150 7:74053264-74053286 ATTCCAGTTGTCCCAGGTGCTGG 0: 1
1: 0
2: 2
3: 21
4: 256
1026904144_1026904149 -2 Left 1026904144 7:74053237-74053259 CCAGGTGTTGGTGTCCCAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1026904149 7:74053258-74053280 GCTGGGATTCCAGTTGTCCCAGG 0: 1
1: 0
2: 6
3: 67
4: 531
1026904144_1026904153 13 Left 1026904144 7:74053237-74053259 CCAGGTGTTGGTGTCCCAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1026904153 7:74053273-74053295 GTCCCAGGTGCTGGGATCCCAGG 0: 1
1: 0
2: 6
3: 124
4: 2285
1026904144_1026904157 28 Left 1026904144 7:74053237-74053259 CCAGGTGTTGGTGTCCCAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1026904157 7:74053288-74053310 ATCCCAGGTGCTGCGGTTCCAGG 0: 1
1: 0
2: 1
3: 18
4: 294
1026904144_1026904151 5 Left 1026904144 7:74053237-74053259 CCAGGTGTTGGTGTCCCAGGAGC 0: 1
1: 0
2: 1
3: 20
4: 175
Right 1026904151 7:74053265-74053287 TTCCAGTTGTCCCAGGTGCTGGG 0: 1
1: 0
2: 2
3: 144
4: 4357

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026904144 Original CRISPR GCTCCTGGGACACCAACACC TGG (reversed) Exonic
900537729 1:3187168-3187190 ACTCAAGGGACCCCAACACCGGG - Intronic
902860742 1:19243649-19243671 GTTCCTGGGAGACTAACATCGGG - Exonic
903514493 1:23901519-23901541 GCTCCTCGGACAGCACCAACGGG - Intronic
904374537 1:30071861-30071883 GGCCCTGGGCCACCAACACGTGG - Intergenic
905298325 1:36968784-36968806 GCTCCTGAGACACCCACTGCTGG - Intronic
906026517 1:42678725-42678747 GCTGCTGTGTCCCCAACACCTGG + Intergenic
907319936 1:53595835-53595857 CCTCCTGAGACACCCCCACCAGG - Intronic
910036267 1:82792603-82792625 GCTCCTGGGACATCAGCTCCTGG + Intergenic
910436040 1:87207308-87207330 TCTCCTGGGACACCTAGCCCAGG + Intergenic
911727686 1:101259091-101259113 GTTCCAGGGCCGCCAACACCTGG - Intergenic
912655801 1:111485475-111485497 GGTCCTGAGACAACCACACCAGG - Intronic
915250765 1:154586705-154586727 CCTCCTGGGACAGCAGCAGCAGG + Intronic
916011359 1:160708901-160708923 TCTCTTGGGACACCAACTCTGGG + Intronic
917920274 1:179744392-179744414 GCTGCTGGGACCCCGCCACCCGG + Intronic
923488652 1:234462230-234462252 GGTCCTGGATCACAAACACCTGG + Intronic
924739574 1:246786938-246786960 GCACCTGGCACACCAGCTCCTGG + Intergenic
1063155650 10:3376722-3376744 GCTCCTGGAACATCATCAGCTGG - Intergenic
1063695728 10:8333146-8333168 GCACCTGCCACACCATCACCGGG - Intergenic
1068350895 10:55843645-55843667 AGTCATGGGTCACCAACACCTGG + Intergenic
1069693320 10:70368956-70368978 GGTCCTGGGTAACCAACATCAGG - Intronic
1069753653 10:70760680-70760702 GCCCCTGAGACACCAATCCCTGG + Exonic
1070427964 10:76307758-76307780 GCTCCTGGGAGGCCACCACGTGG + Intronic
1072654918 10:97323217-97323239 ACACCTGGGACACCGCCACCTGG - Intergenic
1073447943 10:103592250-103592272 GGTCCTGGCACACCACCCCCTGG - Exonic
1075292968 10:121246090-121246112 GCCCCAGGGAAACCATCACCTGG - Intergenic
1076904241 10:133354451-133354473 GCCCCGGGGACACCAGCCCCAGG + Intergenic
1077050014 11:562381-562403 GCCCCTGTGACACCCACACCAGG + Exonic
1079031252 11:16987945-16987967 GATCCTGGGTCACCACCACTGGG + Intronic
1079092467 11:17490825-17490847 GCTCCTGGGCTGCAAACACCAGG + Intergenic
1079274148 11:19018054-19018076 GGTCCTGGGACCCCTTCACCTGG + Intergenic
1081808026 11:45900593-45900615 GCTCCTCGGATCCCAACACCGGG - Intronic
1083476983 11:62921281-62921303 TCTCCAGGGACCCAAACACCTGG + Exonic
1083663259 11:64261854-64261876 GCTCCTGTGACCCCCACACCCGG - Intronic
1086006759 11:82047245-82047267 GCACCTGTAAGACCAACACCAGG - Intergenic
1087170330 11:95043336-95043358 GGGCCTGGGACACCCACCCCTGG - Intergenic
1088842869 11:113641453-113641475 TCTCCTGGCACACAAACACAAGG + Intergenic
1089022223 11:115228133-115228155 GCTCCTGGGACTCCTAGAGCTGG + Intronic
1089492690 11:118893754-118893776 GCTCCAGGATCACCAGCACCAGG - Exonic
1091025100 11:132135113-132135135 TCTCCTGGGACACTGACACAGGG - Intronic
1091793786 12:3286067-3286089 GCTCTTGGGCCACCAAAGCCTGG - Exonic
1092205506 12:6612471-6612493 CCTCCTGAGATACAAACACCTGG - Intergenic
1094498287 12:31002769-31002791 GCTCTTTGGCCACCAAAACCTGG + Intergenic
1096080784 12:48830957-48830979 GCTGCTGGGACAACAAACCCAGG + Intronic
1096779534 12:53984250-53984272 GCTCCTGGGTCACCATCTCAGGG - Intergenic
1097207415 12:57334704-57334726 ACTGCTGGAAAACCAACACCAGG + Intronic
1098214427 12:68200484-68200506 GCTCCTGGGCCATCAGCAGCAGG - Intergenic
1099614207 12:84913431-84913453 GCTGCTGAGGCACCAACACAGGG - Intronic
1100793106 12:98152259-98152281 GCTCCAGGGACACAAAAATCTGG + Intergenic
1100953618 12:99881115-99881137 ACACCTGGTACACCAAAACCAGG + Intronic
1101698611 12:107150830-107150852 GCTCCTGAGTCCCTAACACCTGG + Intergenic
1103478153 12:121233432-121233454 GCTCCTGGGACTTCACCGCCAGG - Intronic
1104639663 12:130459396-130459418 GCTACAGAGACACCACCACCGGG + Intronic
1106402111 13:29441163-29441185 GCTGCAGGGACACCTACACCCGG + Intronic
1106831299 13:33586279-33586301 GATCCTGAGACTCCAAAACCAGG + Intergenic
1107880146 13:44825575-44825597 GCTCCTGAGACATTAACTCCAGG + Intergenic
1109546649 13:63842143-63842165 GCTCTTGGGACCCCATCACGTGG + Intergenic
1109787584 13:67200362-67200384 CCTGCTGGGACACAACCACCTGG - Intronic
1113231287 13:108216223-108216245 GCTCCTGGAACACAAAAACTGGG - Intronic
1113505959 13:110816065-110816087 ACTCCTGGTACACGAACAGCAGG + Intergenic
1113670144 13:112170726-112170748 GCTGCTGGGACCCCAAGCCCAGG - Intergenic
1114460483 14:22883369-22883391 CCTCCAGGGACGCCCACACCAGG + Exonic
1120356652 14:83442765-83442787 GCTCCTGGAGTACCAGCACCAGG - Intergenic
1122427556 14:101620641-101620663 CCACCTGGGACCCCAACTCCAGG - Intergenic
1122993629 14:105250602-105250624 GCTCCTCGGACAGCACCAACGGG + Exonic
1202935898 14_KI270725v1_random:87452-87474 GCTCCTGAGACCCCAAGAACAGG - Intergenic
1126709948 15:51444006-51444028 GTGCCTCGGACCCCAACACCAGG - Intergenic
1128242515 15:66110665-66110687 TCTCTTGGGTCACCAACACCTGG - Intronic
1128270205 15:66302682-66302704 GCTCATGGGTCACCTACTCCAGG + Intronic
1128279736 15:66385257-66385279 CCTGCTAGGTCACCAACACCTGG + Intronic
1129456191 15:75677223-75677245 GCTCCTCGGACACCAACAGCTGG + Exonic
1132470232 16:98439-98461 GCACCTGGGACTCAAACACACGG + Intronic
1133115759 16:3577167-3577189 GCTCCAGGGACAGCAAGACTGGG + Exonic
1133229769 16:4360942-4360964 GCTGCAGGGCCACCAAGACCAGG - Exonic
1134246059 16:12541006-12541028 TTTCCTGGGACAGCAACAACTGG + Intronic
1134684461 16:16148936-16148958 GCTCCAAGGACACAAAAACCAGG - Exonic
1135544515 16:23356801-23356823 GCTCCTGGCAAACCAACCCTGGG + Intronic
1138090584 16:54170518-54170540 GCTCCTGTCACACCACCCCCAGG + Intergenic
1138490379 16:57372919-57372941 CCTCCTGGCACACCCACACCTGG - Intronic
1138563643 16:57816785-57816807 GCTCATGGGAAACCAAGACCAGG + Intronic
1140638759 16:76947256-76947278 GATCCTGGGAGACCACCACATGG + Intergenic
1141736644 16:85858595-85858617 GCTGCTGGGACAGAAACATCTGG - Intergenic
1142044195 16:87914653-87914675 GCTACTGGCACAGCAACACGAGG + Intronic
1142358738 16:89616307-89616329 GGTCCTGGGTCACCCACTCCGGG + Intronic
1144384696 17:14738400-14738422 ACTCATGGGACACCCACATCAGG - Intergenic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1151946361 17:77322027-77322049 CCTCCTGGGCCACCAGCCCCAGG + Intronic
1152255032 17:79234051-79234073 GCGCCTGTGAGGCCAACACCCGG + Intronic
1152791283 17:82281405-82281427 GCTCCTGGAATACCACCCCCAGG - Intergenic
1152855698 17:82663735-82663757 GCTCCTGGGTCCCCCACGCCTGG - Intronic
1152931323 17:83111643-83111665 GCTCCAGGGAAACCACCGCCTGG - Intergenic
1153624125 18:7007148-7007170 ACACCTGTGACCCCAACACCGGG - Exonic
1157711400 18:49852174-49852196 GCTCACGGCACACCAACACAAGG - Intronic
1158861237 18:61594231-61594253 GTTCCTGGGAAACCAACCCAGGG - Intergenic
1161833031 19:6623655-6623677 TCTCCTGGGTCTCCAACTCCTGG - Intergenic
1162158972 19:8697957-8697979 GCCCCTGGGACAGCAGGACCTGG - Exonic
1163464716 19:17460626-17460648 AGTCCTGGGACACGTACACCAGG + Exonic
1166317993 19:41999281-41999303 TCTCCTGGCACACCGACACCTGG + Exonic
925459219 2:4045210-4045232 GACCCTGGGACAGCAGCACCAGG - Intergenic
925992051 2:9261756-9261778 CCACCTGGGACACCACCAGCGGG - Intronic
929386564 2:41414815-41414837 CCTCCTGCCACACCAACACCTGG + Intergenic
930016667 2:46975436-46975458 GCTTCTGGGACACCGAGAGCAGG - Intronic
930719861 2:54628537-54628559 GCTGCTGGAACAGCCACACCAGG - Intronic
932749354 2:74361534-74361556 GCTCCTGGGTCAGCACCAGCCGG + Exonic
935646249 2:105337641-105337663 ACTCCTGGGACAGCAGCTCCGGG - Exonic
937377795 2:121349501-121349523 GCTTGTGGGACACCTACAACTGG + Intronic
945030044 2:205654983-205655005 GCTGGTGGGACACCACAACCGGG + Intergenic
947913964 2:233819988-233820010 GCTGCTGGCGCACCACCACCAGG + Exonic
948682056 2:239641889-239641911 GCTCCAGGGTCACACACACCAGG - Intergenic
948869240 2:240790012-240790034 GCTCCTGGGACACTCATACTGGG - Intronic
1168859302 20:1034472-1034494 TCTCCTGGGACACTCACTCCGGG + Intergenic
1170515833 20:17129449-17129471 GGTCCTGGGACAGGATCACCTGG - Intergenic
1171503481 20:25613391-25613413 GCACCTGGAATACCAGCACCTGG - Exonic
1172800795 20:37574707-37574729 GATCCTGGAACACCAGCACTGGG + Intergenic
1172847189 20:37936686-37936708 GCTCCTGGGACACTAAATGCTGG - Intronic
1173732894 20:45340789-45340811 GTACCTGGGGCTCCAACACCTGG + Intronic
1174140951 20:48413264-48413286 GCTTCTGGGAAACCAAAGCCAGG + Intergenic
1177634861 21:23774195-23774217 GCTGCTGTGATAGCAACACCTGG - Intergenic
1178877605 21:36424871-36424893 CCACAAGGGACACCAACACCAGG - Intergenic
1180280243 22:10687132-10687154 GCTCCTGAGACCCCAAGAACAGG - Intergenic
1181582038 22:23833935-23833957 ACTCCAGGGACCCCAAAACCTGG - Intronic
1182122723 22:27797872-27797894 GCTCCTGGGGCCCCAGGACCCGG - Exonic
1185379738 22:50502920-50502942 CCTCCTGGGAAAGCAGCACCAGG + Intergenic
950026041 3:9820577-9820599 ACTCTGGGGACACCAACACTGGG - Exonic
953344027 3:42160167-42160189 GCTCCTGGCCCAGCATCACCCGG - Intronic
953901304 3:46845680-46845702 GCTCCCGGGACACCCTGACCAGG - Intergenic
954084937 3:48236847-48236869 CCTCCTGGAACACAAACTCCTGG + Intergenic
954363065 3:50132701-50132723 TCTCCTGTGACTCCACCACCAGG + Intergenic
954816510 3:53285789-53285811 GCTCCCTGGACACCATCTCCCGG + Exonic
956716997 3:72087757-72087779 GCTCCTGGGAAACTGGCACCAGG + Intergenic
961326619 3:126112916-126112938 CCTCCTGGGACACCAGCCCCCGG + Intronic
962194713 3:133351498-133351520 GAACCTGGGACACCAAGACAGGG - Intronic
964407164 3:156361174-156361196 GCTCCTGCCACACCATCCCCCGG + Intronic
965165205 3:165188474-165188496 GGTCCAGGGACACAACCACCGGG - Exonic
967074457 3:185989663-185989685 GCTCCAGGCACACCAGCTCCTGG - Intergenic
967136842 3:186519715-186519737 GAGCCTGGGACACCAGCACAGGG + Intergenic
968467942 4:762363-762385 GCCCCTGGGCCACCAGCAGCTGG + Intronic
968524194 4:1047596-1047618 GCTCCTGGGTTCCCAACGCCAGG + Intergenic
968561375 4:1284851-1284873 GCTCCTGGCCCACCCACACAAGG + Intergenic
969726230 4:8920096-8920118 GCTCCTGGGCCACCGAGCCCGGG + Intergenic
975195542 4:71518928-71518950 TTGCCTTGGACACCAACACCAGG - Intronic
979627062 4:122857037-122857059 ACTCCTGGCACAGCAACACCAGG - Intronic
985696953 5:1346060-1346082 GGTCCTGGGCCACCAACCCCTGG + Intergenic
985848034 5:2368332-2368354 GCTGCTTGGACAACATCACCTGG + Intergenic
985868222 5:2533052-2533074 TCTCCTGGGACACACACACCTGG - Intergenic
989169402 5:38459754-38459776 GCTGCTGGGCCCCCAACCCCTGG + Intronic
989280359 5:39634570-39634592 GCCACTGTGACACCAATACCAGG + Intergenic
990381796 5:55226865-55226887 GATCCTCGTACACCGACACCGGG + Exonic
991651765 5:68862908-68862930 GTCCCTGGAACACCATCACCTGG + Intergenic
998334063 5:141355353-141355375 GCTCCCGGGGCGCCAACCCCAGG - Exonic
999741987 5:154562676-154562698 ACTCCTGGGAAAACAACAGCTGG - Intergenic
1002163633 5:177331845-177331867 GCTCCTGAGACACCAGCCCCAGG + Exonic
1002468104 5:179417875-179417897 GCTTCTGGGAGACCTACACAAGG - Intergenic
1006106752 6:31721481-31721503 TCTCCTGTGCCACCAAGACCAGG - Intronic
1008639060 6:53443023-53443045 GCTCCTTTGACACAAAAACCTGG - Intergenic
1008689561 6:53962495-53962517 ACTGCTGGGTCACCAATACCTGG + Intronic
1009496395 6:64353752-64353774 GCTTGGGGGACACCACCACCAGG + Intronic
1010975426 6:82307259-82307281 GTTCCTGAGACACCAGCCCCAGG + Intergenic
1011972135 6:93238837-93238859 ACTGCAGGGACACCAACACAAGG + Intergenic
1013610413 6:111789258-111789280 GATGCTGGGACCCCTACACCTGG - Intronic
1017417292 6:154234460-154234482 GCTTCTGGGAAACCTAAACCAGG + Intronic
1017978017 6:159375128-159375150 GCTCCTGGGAGAGCAACCCTGGG - Intergenic
1020083146 7:5297021-5297043 GCTCCAGCGCCACCGACACCAGG - Exonic
1024228072 7:47343466-47343488 TCTCCTGCAACACCAAAACCGGG - Intronic
1025211137 7:57020166-57020188 GCTCCAGCGCCACCGACACCAGG + Intergenic
1025660818 7:63556681-63556703 GCTCCAGCGCCACCGACACCAGG - Intergenic
1026248400 7:68644875-68644897 GCTGCTGGGCGACCAACTCCAGG + Intergenic
1026904144 7:74053237-74053259 GCTCCTGGGACACCAACACCTGG - Exonic
1026904155 7:74053276-74053298 GCACCTGGGATCCCAGCACCTGG - Exonic
1027674635 7:81142821-81142843 GCTCCTGAGCCAGCAAGACCAGG + Intergenic
1028163254 7:87509406-87509428 GCTCCTGGGACACGATGCCCAGG + Exonic
1029679350 7:102097260-102097282 GCTCCTGGGACATCAGCTCCGGG - Intronic
1029956363 7:104644498-104644520 GCTCCCAGGAAAGCAACACCTGG + Intronic
1032002372 7:128273748-128273770 CCTCCTGGGACACCACCACGAGG + Intergenic
1032421004 7:131778981-131779003 TGTCCTGGGACACCAACAAAGGG - Intergenic
1033704835 7:143876413-143876435 CCTCATGGGACACGACCACCAGG + Exonic
1034262001 7:149763089-149763111 GCCTCTGGGACACCAACATTAGG - Intergenic
1034594969 7:152181222-152181244 CCTCCTGGAACACCAAGACCTGG - Exonic
1034657870 7:152743719-152743741 CCTCACCGGACACCAACACCAGG - Intergenic
1038570692 8:28659610-28659632 GCATCTGGGAAACCGACACCCGG - Intronic
1039120380 8:34139683-34139705 GGTCCTGGGACACCTAAAGCAGG + Intergenic
1047762863 8:127967111-127967133 GCTCATGGGACACCCACCCCAGG + Intergenic
1048755929 8:137738127-137738149 GCTACTGGGATCCCCACACCTGG - Intergenic
1051522223 9:18001901-18001923 ACTCCTGGGTCACCATCATCTGG - Intergenic
1052303425 9:26978131-26978153 CCACCTGGGACAGCAAGACCAGG + Exonic
1053136851 9:35656467-35656489 GCTCAAGGGTCTCCAACACCCGG + Intergenic
1053202967 9:36165206-36165228 CCTCCTGGGACATCTTCACCCGG - Intergenic
1057776853 9:98018367-98018389 GCTCCTGTATCACCACCACCAGG + Intergenic
1060491921 9:124091472-124091494 GATCCTGGGACAGCAAGATCTGG + Intergenic
1060552232 9:124491159-124491181 GCTCCTGCGCCCGCAACACCAGG + Exonic
1061812093 9:133168063-133168085 GTTCCTGGGCCCCCAGCACCTGG + Intergenic
1062384292 9:136303007-136303029 TCTGCTGGGGCCCCAACACCTGG + Exonic
1187020234 X:15373864-15373886 GCTACTTGGACCCCAAAACCAGG - Intronic
1191974396 X:66854900-66854922 GCTCCTGGAACATCATCAGCTGG - Intergenic
1192251723 X:69418878-69418900 TTTCCTGGGATCCCAACACCAGG - Intergenic
1194779209 X:98002810-98002832 TCTCCTGGGACTCCAACTCCTGG - Intergenic
1195647122 X:107245159-107245181 TGTCCTTGGACAACAACACCAGG - Intergenic
1201605191 Y:15776405-15776427 AGTCCTGGAACACCAAAACCTGG + Intergenic