ID: 1026909525

View in Genome Browser
Species Human (GRCh38)
Location 7:74084053-74084075
Sequence GGCCGCGGGGTGTGGGGCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 685
Summary {0: 1, 1: 0, 2: 4, 3: 57, 4: 623}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1026909513_1026909525 14 Left 1026909513 7:74084016-74084038 CCTGGAGGGAAGAACGTATGGGA 0: 1
1: 0
2: 0
3: 7
4: 114
Right 1026909525 7:74084053-74084075 GGCCGCGGGGTGTGGGGCGAGGG 0: 1
1: 0
2: 4
3: 57
4: 623

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1026909525 Original CRISPR GGCCGCGGGGTGTGGGGCGA GGG Intronic
900001575 1:17566-17588 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
900021294 1:188090-188112 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
900101635 1:964542-964564 GGCTGCGGGGAGGGGGGCGCGGG + Intronic
900137885 1:1126124-1126146 GGCCGCGGGGTGGGGGCCGAGGG + Intergenic
900151270 1:1180276-1180298 GGCCGGGTGCTGTGGGGCGATGG - Exonic
900154288 1:1197864-1197886 GGGCGCGGGGCGCGGGGCGCTGG - Exonic
900161011 1:1223797-1223819 GGCCGGGGTGGGTGGGGCGGTGG - Intronic
900226260 1:1534917-1534939 GGCGGAGGGGAGGGGGGCGAGGG - Intergenic
900254955 1:1693162-1693184 TGCCGCGGGGGGTGGGGCCACGG - Intronic
900263704 1:1746442-1746464 TGCCGCGGGGGGTGGGGCCACGG - Intergenic
900342184 1:2194535-2194557 GGCGGCGCGGGGTGGGGCGACGG + Intronic
900418960 1:2547326-2547348 TGCCCCGGGGTGTGGGGCTGTGG + Intergenic
900612843 1:3551674-3551696 GGCAGAGGGGTGTGTGGGGAGGG - Intronic
900621438 1:3589362-3589384 GGGCGTGGGGTGGGGGGCGCAGG - Intronic
900671301 1:3856817-3856839 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
900801052 1:4737317-4737339 GGCCGAGGGGTGGGTGGTGACGG - Intronic
901010980 1:6201964-6201986 GGGCAGGGGGTGTGGGGTGAGGG - Intronic
901197320 1:7447419-7447441 GGGGGCGGGGTGGGGGGTGAGGG + Intronic
901443334 1:9292730-9292752 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
901659853 1:10792322-10792344 GGCCGGGGGGGGGGGGGCGGGGG - Intronic
901793002 1:11664301-11664323 GGCAGCGGGGTCCGGGGCGGGGG + Intronic
902585932 1:17438640-17438662 GGCCGCAGGGTGGGCGGAGAGGG + Intronic
902865403 1:19274414-19274436 GGCCGAGGGATGGGGGACGACGG - Intergenic
902875585 1:19338967-19338989 GGCCGCGGGGTGGGGGCTGGGGG - Exonic
903468372 1:23568136-23568158 GGCCGCCGGGCGCGGGGCGCGGG - Intergenic
903681796 1:25102399-25102421 TGCCGCGGGGTGGGGGACGGGGG + Intergenic
904038281 1:27570322-27570344 GGATGAGGGGTGGGGGGCGATGG - Intronic
904170974 1:28592139-28592161 GGAGGCGGGGGGTGGGGCGGGGG + Intronic
904826373 1:33276245-33276267 GGGAGCGGGGTGAGGAGCGAGGG + Intronic
904989112 1:34577190-34577212 GGGCGAGGGGTGTGGGGCTGGGG - Intergenic
905684900 1:39901304-39901326 GGCGGCGACGTGGGGGGCGATGG + Exonic
907588488 1:55643201-55643223 GGGTGCGGGGTGTGGGGTGTGGG - Intergenic
909392038 1:75130417-75130439 TGCCGCGGGGCGGGTGGCGAAGG + Exonic
909585250 1:77282003-77282025 GGCCGCCAGGGGTGGGGCGCAGG - Intergenic
910153194 1:84179941-84179963 TGTCGCGGGGTGGGGGGCTAGGG - Intronic
911471327 1:98322293-98322315 GGCAGTGGGGGGTGGGGGGACGG + Intergenic
912435413 1:109657684-109657706 GGCTGCAGTGTGTGGGGGGAAGG + Intronic
914845634 1:151282312-151282334 GGCCGCGGGGAGGGCGGCGGTGG + Exonic
915340159 1:155173025-155173047 TGCCGCGCGGTGTGGGGAGTTGG - Intronic
915586361 1:156845905-156845927 GGCCGCGGGGCGGGTGGGGAAGG - Intronic
916890112 1:169106128-169106150 GGGCGCGGGGCGTTGGGCGCGGG - Intronic
917797611 1:178543028-178543050 GGCCGGGAGGTGTGGGGAGGGGG + Intronic
919136020 1:193508879-193508901 TGTCGTGGGGTGTGGGGCAAAGG - Intergenic
921177435 1:212607313-212607335 GGCCGCAGGGTGTGGGGGCACGG - Intronic
922958614 1:229626001-229626023 GGCGGCGGGGCGCGGGGCGCGGG - Exonic
923674131 1:236065274-236065296 GGCCGCGAGGGGGAGGGCGAGGG + Intergenic
924052536 1:240092822-240092844 GGCCCCGGGCTGAGGGGAGACGG - Exonic
924414903 1:243849624-243849646 GGCCGCGCGGCGTGGGGAGGGGG - Intronic
924807632 1:247373855-247373877 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
1062774754 10:135642-135664 GGCCGCGGCCTCTGGGGCGGCGG + Intronic
1062890554 10:1056721-1056743 CGCCGCCGGGTGTGGGGCGGAGG + Intronic
1064148451 10:12843420-12843442 GGCCGGGAGGTGTGTGGCAATGG + Intergenic
1065715981 10:28568689-28568711 TGTCGTGGGGTGTGGGGAGAGGG - Intronic
1066402517 10:35090057-35090079 GGCGACGAGGTGTGGGGAGAGGG - Intronic
1066597048 10:37062450-37062472 GGCCTCGAGGTGTGGAGGGAGGG + Intergenic
1067252562 10:44600152-44600174 TGTCAAGGGGTGTGGGGCGAGGG + Intergenic
1069403473 10:68074810-68074832 GGGTGAGGGGCGTGGGGCGAGGG - Intronic
1070068678 10:73064229-73064251 GGCTGCGGGGTGCGGGGGGGTGG + Intronic
1070327148 10:75396548-75396570 GGCCGCGGGCTGTCGGACGCAGG + Intergenic
1070878105 10:79834203-79834225 TGTCGCGGGGTGGGGGGCAAGGG + Intergenic
1071285392 10:84139658-84139680 GACCGCTGGGTGCGGGGGGAAGG + Intronic
1071306466 10:84303166-84303188 GGCGGCGGGGGGGGGGGCGGGGG + Intergenic
1071340719 10:84645536-84645558 TGTCGGGGGGTGTGGGGCAAGGG - Intergenic
1071695443 10:87864147-87864169 GGCCACGGGGGGTGCGGCGGCGG - Exonic
1072253623 10:93600852-93600874 GGCCGCGGGGAGGGCGGGGATGG + Intronic
1072757516 10:98030699-98030721 GGGCCCGGGGTGGGGGGCGCCGG + Exonic
1073048775 10:100654922-100654944 AACCCCGGGGTGAGGGGCGATGG - Intergenic
1073289207 10:102405120-102405142 GGCTGGTGGGTGTGGGGTGATGG - Intronic
1073325908 10:102643977-102643999 GGGCGCGGGCTGCGGGGCGCGGG - Intergenic
1074086132 10:110210038-110210060 GGCGGCGGGGTGGGGGGTGGGGG - Intronic
1074898237 10:117795305-117795327 GGCCACAGGCTGTGGGGCGATGG + Intergenic
1075040629 10:119104389-119104411 GGCCGCGGGCGGGCGGGCGAGGG - Intronic
1075282905 10:121155966-121155988 GGCTGCCTGGTGTTGGGCGAGGG + Intergenic
1076120586 10:127934005-127934027 GTGCGCGGGGGGTGGGGGGAAGG - Intronic
1076255573 10:129021936-129021958 GGCGGCGGGGTTTGGGGACAAGG - Intergenic
1076676357 10:132149577-132149599 GGCGGAGGGGGGTGGGGCGGGGG - Intronic
1076676370 10:132149598-132149620 GGCGGAGGGGGGTGGGGCGGGGG - Intronic
1076680191 10:132167816-132167838 GGCCGAGGGGTGAGGGCCGAGGG - Intronic
1076680202 10:132167844-132167866 GGCCGAGGGGTGAGGGGCGAGGG - Intronic
1076680211 10:132167865-132167887 GGCCGAGGGGCGAGGGGCGAGGG - Intronic
1076793475 10:132788167-132788189 GGGCGCGGGATGAGGGGCCAGGG + Intergenic
1076921126 10:133455340-133455362 GGCTGGGGGGTGTGGAGGGATGG + Intergenic
1077008315 11:369376-369398 GGGCGCGGGGTGCGGGGCGGAGG - Intergenic
1077108071 11:850425-850447 GGTCGCGGGGTCTGGGGAGTCGG + Intronic
1077167564 11:1150632-1150654 GGCCGAGGGGTGGGGGGAGGGGG + Intergenic
1077211822 11:1374800-1374822 GGCTGCGGGGGGCGGGGGGAGGG - Intergenic
1077214539 11:1389975-1389997 GGGCGCGGGGCGCGGGGCGCGGG + Intronic
1077432957 11:2525115-2525137 GGCTGCAGGGTGTGGGGACAGGG + Intronic
1077544910 11:3165094-3165116 GGCCGCGGGGGGCCGGCCGAAGG - Intronic
1078621161 11:12909519-12909541 TGTTGCGGGGTGGGGGGCGAGGG + Intronic
1079166295 11:18046347-18046369 GGCCGGCGGGTGTGGGGCGTGGG + Intergenic
1079489518 11:20972025-20972047 GGGAGCGGGGTGGGGGGCAAGGG + Intronic
1080779971 11:35420206-35420228 GGCCGAGGGGTGAGTGGCGGGGG + Intergenic
1080836338 11:35944178-35944200 GGGCGCGGGGCGCGGGGCGCGGG + Intronic
1081157595 11:39714646-39714668 GTCGGCGGGGTGAGGGGCTAGGG + Intergenic
1081831528 11:46120012-46120034 GGCCCCGGGGTGAGGGGTGCAGG + Intronic
1081995131 11:47359183-47359205 GGGTGCAGGCTGTGGGGCGAGGG + Intronic
1083227775 11:61295367-61295389 GGGCAGGGGGTGTGGGCCGAGGG - Exonic
1083340473 11:61955684-61955706 GGGCGGGGGGCGAGGGGCGAGGG - Intronic
1083702893 11:64491500-64491522 GGCCGAGGGGGGTGGGGGCACGG + Intergenic
1083758277 11:64802812-64802834 GGGCGCGGGGTGCGGGCGGAGGG - Intronic
1083799991 11:65041197-65041219 GGCCGGGGGGTGGGGAGCGGCGG - Exonic
1084083843 11:66845726-66845748 GGCCGTGGTGTGTGGGTGGATGG + Intronic
1084102299 11:66957857-66957879 AGCCGCGGCGTGTAAGGCGAGGG - Intronic
1084225391 11:67711895-67711917 GGCCGCGGGATGCGGGGCTGAGG + Intergenic
1084268069 11:68015046-68015068 GGCAGAGGGGAGTGGTGCGAGGG + Intronic
1084333979 11:68446359-68446381 GCCCGAGGGGTGTGGGAGGAAGG + Intronic
1084561912 11:69910171-69910193 GACCCCGGGGTGTGGGGAGTGGG - Intergenic
1085043998 11:73343084-73343106 GGCGGCGGGGCGGGGGGCGGGGG - Intronic
1086322715 11:85667187-85667209 GGCGGCGGGGGGTGGGGGGTTGG - Intronic
1086418263 11:86611231-86611253 GGGCCCGGGGTGTGGGGAAATGG + Intronic
1086827704 11:91519452-91519474 GGCAGGGGGGTGGGGGGCGGGGG + Intergenic
1087907085 11:103710688-103710710 GGAGGCAGGGTGTGGGGCAAGGG + Intergenic
1089002142 11:115060736-115060758 GGCAGGGGGCTGTGGGGGGACGG - Intergenic
1089309363 11:117547630-117547652 GCACGCGGGGTGTTGGGGGAGGG - Intronic
1089622520 11:119729769-119729791 GGCAGCGGTGCGCGGGGCGACGG + Intergenic
1089915626 11:122153006-122153028 GGGCGGGGGGTGCGGGGGGAAGG - Intergenic
1090198889 11:124839825-124839847 GGCCGCGGGGCGGGAGGGGAAGG - Intergenic
1090606826 11:128430533-128430555 TGTCGTGGGGTGTGGGGCGGGGG - Intergenic
1090619593 11:128549261-128549283 GGGCGAGGGGCGAGGGGCGAGGG - Intronic
1090619596 11:128549268-128549290 GGGCGAGGGGCGAGGGGCGAGGG - Intronic
1090799138 11:130159889-130159911 GGGCGCGGGGCGCGGGGCGCAGG - Exonic
1090862178 11:130663703-130663725 GGTCGCGGGGTGCGGGGCAGGGG + Intergenic
1091000901 11:131910461-131910483 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1091361084 11:134978793-134978815 GGCCCCTGGGTGTGGGCGGAGGG - Intergenic
1091374661 12:17683-17705 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
1091440287 12:507595-507617 GGGCGTAGGGTGTGGGGTGAGGG - Intronic
1091440527 12:509191-509213 GGGGGCTGGGGGTGGGGCGAAGG - Intronic
1091445358 12:541849-541871 GGCCGGGGGGTGGGGGGGGGTGG - Intronic
1091712642 12:2752810-2752832 GGGCGCGGGGTGTGGCGCGGCGG + Intergenic
1091754792 12:3044329-3044351 GCCGGTGGGGTGTGGAGCGAGGG + Intergenic
1091807358 12:3366004-3366026 GCCCGCGTGGGGTGGGGCGCCGG - Intergenic
1093654050 12:21674918-21674940 GGTGGCAGGGTGTGGGGAGAAGG - Intronic
1093673508 12:21905259-21905281 TGTCGTGGGGTGTGGGGAGAGGG + Intronic
1096372832 12:51083310-51083332 GGCCTAGGGGTGCGGGGCGGAGG - Intronic
1096513772 12:52145560-52145582 GATCGAGGGGTGTGGGGTGAGGG + Intergenic
1097050887 12:56222378-56222400 GGCCGCGGGGTGGGGAGTGAGGG + Intronic
1097123377 12:56753217-56753239 GGGGGCGGGGAGTGGGGGGAGGG + Intronic
1097267651 12:57755307-57755329 GGCGGCGGGGTGGGCGGCCATGG - Exonic
1097854922 12:64452199-64452221 GGCCGCGGGCTGAGGGGCCAAGG + Intronic
1097898286 12:64848420-64848442 TGTCGCGGGGTATGGGGCTAAGG - Intronic
1098254800 12:68606092-68606114 GGCGGCGGGGGGGGGGGGGAGGG + Intergenic
1099687645 12:85909830-85909852 TGCCGGGGGGTGGGGGGCAAGGG + Intergenic
1099956281 12:89354342-89354364 GGGTGCGGGGCGTCGGGCGAAGG - Intergenic
1100726733 12:97416877-97416899 GGGTGGGGGGTGTGGGGGGAGGG + Intergenic
1101302414 12:103495685-103495707 GGCAGGGGGGTGGGGGGCCAAGG - Intronic
1101612399 12:106303293-106303315 GGCCGAGGAGTGTGGGGGAAGGG - Intronic
1101961793 12:109256289-109256311 GGCCCCGAGGTGTGAGGCCAGGG + Intronic
1102539716 12:113610009-113610031 GGCCGAGGGGGCTGGGGGGAGGG + Intergenic
1102682163 12:114698275-114698297 CGCCGCGGGCGGTGGGGCGGAGG - Intergenic
1103999887 12:124853816-124853838 GGCAGCTCGGTCTGGGGCGACGG + Intronic
1104961617 12:132490745-132490767 GGACGCGCGGTGCGGGGCGCGGG - Exonic
1104983761 12:132585483-132585505 GGTCGCTGGGGGTGGGACGACGG - Intergenic
1104989780 12:132618997-132619019 GGGCGCGGGGTGCGGGGCGCGGG + Intronic
1104989785 12:132619011-132619033 GGGCGCGGGGTGCGGGGCGCAGG + Intronic
1105621860 13:22075689-22075711 GGCAGCGGGGAGTGGGGAGGAGG - Intergenic
1106109089 13:26760935-26760957 GGCCCAGGGGCGCGGGGCGAGGG + Intergenic
1106109093 13:26760942-26760964 GGGCGCGGGGCGAGGGGCGAAGG + Intergenic
1106502424 13:30341798-30341820 GGTGGCGGGGTGGGGGGCGGGGG - Intergenic
1107073605 13:36297894-36297916 GGCGGCAGGGGGTGGGGCGAGGG + Intergenic
1113191362 13:107750874-107750896 GGCCGGGGGCTGTGGGGGCAGGG - Intronic
1113417091 13:110136916-110136938 GGCCGTGGGGTGTGGAGACAGGG + Intergenic
1113813088 13:113154049-113154071 GGGCGCGGGGGGCGGGGCGTGGG + Intergenic
1113932033 13:113973772-113973794 GGCCGCGGGGAGCGGGTGGACGG - Intergenic
1115578718 14:34737068-34737090 TGTCGGGGGGTGTGGGGCTAGGG - Intergenic
1115851754 14:37595026-37595048 GGCCGCGCGGCGCGGGGCGGGGG + Exonic
1117980810 14:61340373-61340395 GGGGGCGGGGTGGGGGGCGGGGG + Intronic
1118320189 14:64748384-64748406 TGCCACTGGGAGTGGGGCGAGGG + Exonic
1118615622 14:67572773-67572795 AGCAGAGAGGTGTGGGGCGAGGG - Intronic
1119219371 14:72893602-72893624 GGCCGCGGGCTCGGGGGCGCGGG + Intronic
1119595175 14:75926072-75926094 GGCCGTGGGCCGTGGGGAGAGGG + Intronic
1119602025 14:75982677-75982699 GGCTGCGGGGTGGGGGCTGAGGG + Intronic
1120207519 14:81602408-81602430 TGTCGCGGGGTGGGGGGCAAGGG - Intergenic
1122123092 14:99565020-99565042 GGCCGCGGGCTGCCGGGAGAGGG - Intronic
1122277920 14:100604798-100604820 GGGCACGGGGGGTGGGGGGAGGG - Intergenic
1122444967 14:101761621-101761643 GGCCGGGGGGTGGGAGGAGAGGG + Intergenic
1122719965 14:103716245-103716267 GGAGGCGGGGTGCGGGGCGCGGG + Intronic
1122779093 14:104136188-104136210 GGACTGGAGGTGTGGGGCGACGG - Intergenic
1122828220 14:104382609-104382631 GGCTGTGGGGTGTGGGGCAAGGG + Intergenic
1122898921 14:104774090-104774112 GGCAGTGTGGTGTGGGGCTACGG - Intronic
1122905747 14:104800752-104800774 GGCCGCGGGGAGCGGGGAGAGGG - Intronic
1123053529 14:105559141-105559163 GGCGGCTGGGTGTGGGGCTGGGG - Intergenic
1123078107 14:105679556-105679578 GGCGGCTGGGTGTGGGGCTGGGG - Intergenic
1124469170 15:29968407-29968429 GCCCGCGGCGCGTAGGGCGACGG - Intronic
1124922387 15:34039164-34039186 AGGCGCGGGGTGCGGGGCTAGGG + Exonic
1125508297 15:40279954-40279976 GGCGGCGGGGTTGGGGGCGGGGG - Intronic
1127857153 15:62962252-62962274 GGGACCGGGGTGTGGGGTGAAGG - Intergenic
1128543892 15:68554838-68554860 GCCCCCAGGGTGTGGGGCCAGGG + Intergenic
1128705933 15:69837525-69837547 GGATGTGGGGTGTGGGGGGAGGG + Intergenic
1129472239 15:75762279-75762301 GGCTGCAGGGTTTGGGGCCAGGG + Intergenic
1129677912 15:77642372-77642394 GGCCCCATGGTGTGGGGAGAGGG + Intronic
1130270650 15:82445281-82445303 GGTTGAGGGGTGAGGGGCGACGG + Intergenic
1130301180 15:82680671-82680693 GGGCGCGGGGTCTGAGGAGACGG - Exonic
1130462994 15:84172604-84172626 GGTTGAGGGGTGAGGGGCGACGG + Intronic
1130489680 15:84422184-84422206 GGTTGAGGGGTGAGGGGCGACGG - Intergenic
1130501271 15:84500946-84500968 GGTTGAGGGGTGAGGGGCGACGG - Intergenic
1130923083 15:88365392-88365414 GGCAGAGGGGTGGGGGGCCAGGG + Intergenic
1131052695 15:89359107-89359129 GGTCGCGGGGCGCGGGGCGCCGG - Intergenic
1132275385 15:100559075-100559097 GGCCGCGCGCTGGGAGGCGAGGG - Intergenic
1132319989 15:100918967-100918989 GGCCGCAGTGTGTGGGCCGCAGG + Intergenic
1132451934 15:101973370-101973392 GGCCGAGGGGTGTGGGCGGGAGG + Intergenic
1132454961 16:17251-17273 GGCCGAGGGGTGTGGGCGGTAGG - Intronic
1132683506 16:1153173-1153195 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
1132683509 16:1153180-1153202 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
1132745488 16:1434566-1434588 GGCCATGGGGGGTGGGGCGGGGG - Intronic
1132804982 16:1771236-1771258 GGGGGCGCGGTGTGGGGGGAAGG - Intronic
1132831310 16:1929760-1929782 GGCCGCGGGGGTTGCGGCGGAGG - Intergenic
1132978290 16:2721227-2721249 GGCCGTGGGGTCGGGGGCGCCGG + Intergenic
1133680231 16:8114375-8114397 GGGCGAGGGGAGAGGGGCGAGGG - Intergenic
1134482266 16:14630061-14630083 GGCAGCCGGGTGTGGGGAGGCGG + Intronic
1134884624 16:17778828-17778850 GGCGGCTGGGTATGGGTCGATGG - Intergenic
1136393913 16:29982674-29982696 GGCTGTGGGTTGTGGGGGGAAGG + Intronic
1136579491 16:31142992-31143014 GGCTGCGGGATGGGGGCCGAGGG + Exonic
1136585150 16:31179839-31179861 GCCCGCTGGGGGCGGGGCGAGGG - Intergenic
1137720131 16:50622910-50622932 GGCCGAGGGGTGTGGGGTAACGG + Intronic
1138247631 16:55479292-55479314 GGCGGCGGGGGCTGGGGCGCGGG + Exonic
1138390922 16:56669471-56669493 GGCCCCGGGGTGTGGGGCGCAGG + Intronic
1138516096 16:57536254-57536276 GGCCGCGGGGTGATGGGGGAGGG - Intronic
1138619110 16:58197796-58197818 GGACGCGGGGCGTCGGGCGGAGG + Exonic
1138873159 16:60917340-60917362 GGGTGGGGGGTGTGGGGTGATGG + Intergenic
1139442334 16:66974502-66974524 GCCCACGGGGGGTGGGGGGAGGG - Exonic
1139469718 16:67171570-67171592 GGCAGTGGGGTGTGGGGGGGAGG + Intronic
1139598180 16:67969839-67969861 GGCTGCGAGGTGGGTGGCGAGGG - Intergenic
1139806113 16:69566383-69566405 GGCTGTGGGGGGTGGGGCGTGGG + Intronic
1140096903 16:71883669-71883691 GGGCGCGGGGTGCGGGGCCGGGG - Intronic
1140707379 16:77643353-77643375 GGGCGGGGGATGTGGGGCGGGGG + Intergenic
1141126614 16:81405040-81405062 AGCAGCGGGGTGTGAGGTGAGGG - Intergenic
1141158887 16:81616263-81616285 AGCCTCAGGGTGTGGGCCGAGGG + Intronic
1141620711 16:85235389-85235411 CGCAGCGGGGGGTGGGGTGAGGG + Intergenic
1141638840 16:85329591-85329613 GGCTGCGGGGTGCGGGGAGAGGG + Intergenic
1142263619 16:89053744-89053766 ATCCGCGAGGTGTGGGGAGACGG - Intergenic
1142518730 17:490261-490283 AGCCGCGGGGTGTCGGGCCGGGG + Intergenic
1142852604 17:2711517-2711539 GGCCGCTGGGCGGGGGGCGCCGG - Intronic
1143018536 17:3904457-3904479 GGCCCTGGGGGGTGGGGAGAGGG - Intronic
1143773447 17:9182680-9182702 GGCAGGGGGGTGTGGAGAGAAGG - Intronic
1144425047 17:15133669-15133691 GGAAGCGGGGTGGGGGGCCAGGG - Intergenic
1144735016 17:17550474-17550496 AGCTGCGGGGAGTGGGGGGAAGG - Intronic
1144953026 17:19004212-19004234 GGCCGCGCGGGGAGGGGCGGCGG + Intronic
1144956989 17:19023640-19023662 AGCCGCGGGGTGGGGGGTGGGGG - Intronic
1145305754 17:21674265-21674287 GGCTGCGGGGACTGGGGCGGCGG + Intergenic
1145370897 17:22305217-22305239 GGCTGCGGGGACTGGGGCGGTGG - Intergenic
1145693115 17:26765877-26765899 GGCAGCGGGGTGGGGGGGGGGGG - Intergenic
1145850644 17:28092262-28092284 GGCGGGGGGGTGGGGGGAGAAGG + Intronic
1146022635 17:29292894-29292916 GGCCGCGGTGCGGGGGGCGCCGG + Intronic
1146034087 17:29390825-29390847 GGCGGCGGGGGGTGGGGGGGGGG - Exonic
1147156729 17:38547833-38547855 GGCGGCGGGGCGTGGGGGGGAGG + Intronic
1147943449 17:44066391-44066413 GGTCGGGGGGTGGGGGACGACGG - Intronic
1148111476 17:45147034-45147056 GGTCACTGGGTGTGTGGCGAAGG + Intergenic
1148177598 17:45581167-45581189 ATCCGGGGGGTGGGGGGCGAGGG + Intergenic
1148342960 17:46884367-46884389 GGGGGCTGGGTGTGGGGCGGGGG - Intronic
1148495045 17:48048514-48048536 GGCCGAGGCTTATGGGGCGACGG + Intronic
1148782490 17:50129714-50129736 GGGCGGGGGATGTGGGGAGAGGG + Exonic
1148830164 17:50426063-50426085 GGCCGCGGGGTCGGAGGGGAAGG + Intergenic
1149810510 17:59665449-59665471 TGCCACTGGGTGTGGGGAGAGGG + Intronic
1150249994 17:63699959-63699981 CGCCGAGGGGTGTGGGGTGAGGG - Intronic
1150473841 17:65459616-65459638 GTCGGCGGGGTGGGGGGTGATGG + Intergenic
1151471201 17:74318918-74318940 GGCAGCTTGGAGTGGGGCGATGG + Intergenic
1151828702 17:76537590-76537612 GGGCGCGGGGCGCGGGGCGCGGG + Exonic
1151828704 17:76537597-76537619 GGGCGCGGGGCGCGGGGCGCCGG + Exonic
1152175149 17:78782320-78782342 GGGCGCGGGGCGCGGGGCGCCGG - Intergenic
1152197339 17:78925310-78925332 GGCGGCGGGGTGGGGGGCGGCGG + Exonic
1152323940 17:79624808-79624830 GGGCGGGGGGTGGGGGGCGGGGG - Intergenic
1152352571 17:79791754-79791776 GGCCTGGGGGTGTGGCGCGCTGG + Intergenic
1152617832 17:81346025-81346047 GGCCGCGGGGCGCGGGGCGCTGG - Intergenic
1152636570 17:81432784-81432806 GGCCTGGGGATGTGGGGGGAGGG - Intronic
1152641792 17:81452371-81452393 GGCCGCAGGGTGGCGGGTGAGGG + Intronic
1152689682 17:81712329-81712351 GGGCGCGGGGCGCGGGGCGCGGG + Exonic
1152714477 17:81891870-81891892 GGGCGCAGGGGGTGGGGCGGCGG + Intronic
1152724199 17:81937179-81937201 GGTCGCCGGGTGGGGCGCGACGG - Exonic
1152922385 17:83072562-83072584 GGCTGGAGGGTGTGGGGCGGGGG + Intergenic
1153515278 18:5895739-5895761 GGCCGCGGGGCAGGGGGCGCGGG + Intronic
1154132747 18:11750920-11750942 GTGCGCTGGGTGAGGGGCGAAGG + Intronic
1154494218 18:14944160-14944182 GGCCCCTGGGTGTGGGCGGAGGG + Intergenic
1154991664 18:21602808-21602830 GGGGGCGGGGGGTGGGGCGGGGG + Intergenic
1155392098 18:25349601-25349623 GGCCGGGAGGCGTGGGGCGCCGG + Intronic
1156000536 18:32379457-32379479 GGCCGGGGGGGGTGGGGGGCGGG + Intronic
1156079534 18:33316463-33316485 GCCCACGGCGTGTGGGGGGAGGG - Intronic
1156350433 18:36297662-36297684 GGCCGCGGGGGGCGGGGCGGGGG - Intergenic
1157529526 18:48409483-48409505 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1157816185 18:50730797-50730819 GGGGGCCGGGTGTGGGGTGAAGG - Exonic
1159586592 18:70288828-70288850 GGCCGCGCGGGGCGGGGCGGGGG - Intergenic
1160058197 18:75506122-75506144 GGCTTGGGGGTGTGGGGAGATGG + Intergenic
1160499844 18:79396193-79396215 GGCGGCGGGGAGTGGAGCGGCGG - Intronic
1160501003 18:79400967-79400989 GTCTGCGGGGCGTGGGGAGACGG - Intronic
1160592714 18:79952785-79952807 GGCGCGGGGGTGTGAGGCGAGGG + Intergenic
1160747501 19:718998-719020 GGCTGCGAGGTGTGGGGTGCGGG - Intronic
1160784421 19:892884-892906 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1160784424 19:892891-892913 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1160784427 19:892898-892920 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1160784430 19:892905-892927 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1160784433 19:892912-892934 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1160784436 19:892919-892941 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1160834756 19:1119465-1119487 GGCGGCGGGGGGTGGGGAGGAGG - Intronic
1160864129 19:1249669-1249691 GGGCGCTGGGGGCGGGGCGAGGG + Intronic
1161313263 19:3606620-3606642 GGGCGCCGAGGGTGGGGCGAGGG + Exonic
1161342610 19:3751394-3751416 GGCCCCGGGGTGGGGGGGTAGGG - Intronic
1161378079 19:3950353-3950375 GGCCCTGGGGTGGGGGGCGGGGG - Intergenic
1161957165 19:7502678-7502700 GGCTGGGGGGTGTGGGGAGGAGG - Intronic
1161993484 19:7698541-7698563 GGATGCTGGGTGTGGGGTGAGGG + Intronic
1162312035 19:9913622-9913644 GGCCGCGGGGCATGAGGCGGAGG - Intronic
1162780013 19:13002107-13002129 GGCCCAGGGGTGTGGGGCCCAGG - Intronic
1162799428 19:13102771-13102793 GGCCGCCGGGGGCGGGGAGAAGG - Exonic
1162799668 19:13103580-13103602 GGCCGGGTGCTGTGGGGTGAGGG - Intergenic
1162804412 19:13129591-13129613 GGACGAGCGGAGTGGGGCGACGG - Intronic
1163609216 19:18292364-18292386 GGCCGCGGGGATGGGGGCGGGGG + Intergenic
1163622117 19:18367340-18367362 GGCTGAGGGGTGTGGTGGGAAGG + Exonic
1163689685 19:18731805-18731827 TGCCCCGGGGGGTGGGGGGAAGG + Intronic
1163698962 19:18777658-18777680 GGCCCCGGGGCTGGGGGCGAGGG - Exonic
1163842249 19:19618583-19618605 CGCCGCGGGGCGGGGGGCGATGG + Exonic
1164189571 19:22901794-22901816 GACCGCGGGCTGTGGTGGGAAGG + Intergenic
1164639030 19:29811714-29811736 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
1164664773 19:30021226-30021248 GGAGGCCGGGTGTGGGGTGAGGG - Intergenic
1165070935 19:33254473-33254495 GGCAGCGGGGTGGGGGCCGTGGG + Intergenic
1165459603 19:35936697-35936719 GGGCGCGGGGTCCGGGGCGGCGG - Intronic
1165511487 19:36268975-36268997 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165512035 19:36271498-36271520 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165512583 19:36273997-36274019 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165513134 19:36276540-36276562 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165513689 19:36279093-36279115 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165514238 19:36281627-36281649 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165514792 19:36284166-36284188 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165515344 19:36286697-36286719 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165515894 19:36289235-36289257 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165516445 19:36291770-36291792 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165516997 19:36294298-36294320 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165517550 19:36296821-36296843 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165518102 19:36299356-36299378 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165518653 19:36301891-36301913 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165519201 19:36304421-36304443 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165519750 19:36306936-36306958 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165520301 19:36309466-36309488 GGCTGCGGGGCCTGGGGCGGCGG - Intergenic
1165623769 19:37269116-37269138 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165624312 19:37271656-37271678 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165624859 19:37274183-37274205 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165625396 19:37276721-37276743 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165625929 19:37279246-37279268 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165626473 19:37281773-37281795 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165627012 19:37284298-37284320 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165627555 19:37286822-37286844 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165628090 19:37289346-37289368 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165628632 19:37291872-37291894 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165629172 19:37294397-37294419 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165629715 19:37296923-37296945 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165630257 19:37299450-37299472 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165630796 19:37301988-37302010 GGCTGCGGGGCCTGGGGCGGCGG + Intergenic
1165813109 19:38624216-38624238 GGCCGGGGGGTGTGTGGGAAGGG + Intronic
1165814784 19:38635135-38635157 GGCCTCGGGCTTTGGGGCTAAGG + Intronic
1166660934 19:44647080-44647102 GACCGTGGGGTGTGGGGGGAGGG - Intronic
1167457061 19:49601807-49601829 GGCGGCAGTGTGTGGGGAGACGG + Exonic
1167515145 19:49918904-49918926 GGGGGCGGGGTGTGGGGGGGCGG + Intronic
1168064017 19:53909337-53909359 GGCCGCGGGGGGTGGGGGGTGGG + Exonic
1168102504 19:54148547-54148569 GGCAGCGGGGTGGGGGGCGTGGG + Intronic
1168152666 19:54457202-54457224 GCCCGTGGGCTGTGGGGCGTGGG + Intronic
1168255328 19:55161629-55161651 GACCGCGGGGTGAGGGGCCCAGG - Exonic
1168290594 19:55355199-55355221 GGGCGGGGGGAGGGGGGCGAGGG - Intronic
925157656 2:1659986-1660008 GCCTGCGGGGAGTGGGGTGATGG + Intronic
926107682 2:10162678-10162700 GGCAGGGGGGTGGGGGGCGGCGG - Intronic
926820174 2:16843372-16843394 TGTTGCGGGGTGGGGGGCGAGGG - Intergenic
927125944 2:20012536-20012558 GGCCACGGGGTCGGGGGCGGCGG + Exonic
927505105 2:23607808-23607830 GGGCTGGGGGTGTGGGGAGATGG - Intronic
927685649 2:25168693-25168715 GGCCGCGGGGCGTGGGAGGGGGG + Exonic
927900621 2:26815766-26815788 GGCCGCCGGGTGGGGGGCGCCGG + Intergenic
929242270 2:39665662-39665684 GTGCGCGGGGTGGGGGGCGCCGG + Intronic
931748042 2:65307931-65307953 GGGCGGGGGGTGTGGGGAGGAGG - Intergenic
931882275 2:66579651-66579673 GGCTGCGGGGGGGGGGGCGGGGG + Intergenic
932179170 2:69630330-69630352 GGGCGGGGGGTGGGGGGGGAGGG + Intronic
932437381 2:71710623-71710645 GGCCACAGGGTGTGGGGACAAGG - Intergenic
933657936 2:84905059-84905081 GGCGGGGGGGTGTAGGGGGAGGG - Intronic
934045562 2:88170420-88170442 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
934045565 2:88170427-88170449 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
934060044 2:88284546-88284568 GGCTGCGGTGTCTGGGGCAAGGG + Intergenic
934107240 2:88706549-88706571 GTCTGGGGGGTGTGGGGGGAGGG + Intronic
934685986 2:96321961-96321983 GGAGGCGGGGTCGGGGGCGAAGG + Intergenic
934770793 2:96906693-96906715 GGGCTCTGGGTGTGGGGCCACGG - Intronic
934966909 2:98731235-98731257 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
935622936 2:105144391-105144413 GGCCGCGGGGTCGGGGGAGGGGG + Intergenic
935645295 2:105329583-105329605 GGGCGCGGGGTGCGGGGCTCAGG - Intronic
936568149 2:113595847-113595869 GGCCGAGGGGTGTGGGCGGGAGG + Intergenic
937418666 2:121737236-121737258 GGCAGCGGGGTCTGGGGCTGGGG + Intronic
938765753 2:134459730-134459752 GGGAGGGGGGTGTGGGGCTAGGG - Intronic
938829295 2:135034807-135034829 GACCGTGGGCTGTGGGGAGAGGG + Intronic
939153923 2:138502134-138502156 TGCCGCGGGGACTGGGGGGAGGG - Intronic
939326696 2:140700088-140700110 GGCGGGGGGGTGGGGGGTGAGGG + Intronic
939841149 2:147188366-147188388 TGTCGCGGGGTACGGGGCGAGGG + Intergenic
941794358 2:169583757-169583779 GGCGGGGGGGTGGGGGGGGATGG - Intergenic
941808726 2:169734450-169734472 GGGCGCGGGGGAGGGGGCGAGGG + Intronic
942351621 2:175058527-175058549 AGCTGTGGGGTGTGGGGAGACGG - Intergenic
943999311 2:194811879-194811901 GGGTGCGGGGTGTGGGGAGGGGG + Intergenic
945492895 2:210476708-210476730 GGCTGCGGGGTGAGAGGCCAGGG - Exonic
946245975 2:218387696-218387718 GGCCGCGGGCTGCGGGGGGCTGG + Intronic
946959241 2:224966288-224966310 GGCCACGGGGGGTGGGGGGTGGG - Intronic
947792652 2:232876855-232876877 GGCCCCGGGGAGCGCGGCGAGGG - Intronic
948027948 2:234792778-234792800 GGCCCCGGGGTGCGGGACAATGG + Intergenic
948116029 2:235494625-235494647 GGCCCCGGGGCGCGGGGCGGCGG + Exonic
948502751 2:238407041-238407063 GGCCGACGGCTGTGGGGAGAGGG + Intergenic
948505975 2:238427141-238427163 GGCCGCGGGGCGTGTGGGGATGG + Intronic
948593908 2:239067585-239067607 GGCCGGGTGCTGTGGGGCGTTGG + Intronic
948814479 2:240502863-240502885 GGCCTGGGGGTGTAGGGCGGAGG - Intronic
948887622 2:240892081-240892103 GGTCCTGGGGTGTGGGGTGAGGG - Intronic
1168802758 20:653535-653557 GGCCGCGGGGGCGGGGGCGGGGG + Intronic
1169673815 20:8132567-8132589 GGGCGCGGGGCGCGGGGCGCGGG - Intronic
1170214222 20:13874931-13874953 GGCCGATGGGTGTGGGATGAGGG + Intronic
1170562769 20:17570571-17570593 GGCCGGGGAGTGGGGGGCGGGGG + Intronic
1171121501 20:22572653-22572675 TGCCGCGGGGGCTGGGGCCAGGG + Intergenic
1171249583 20:23637879-23637901 GGACGCGGGGAGTGGGGCGCAGG + Exonic
1171531009 20:25853732-25853754 GGCTGCGGGGACTGGGGCGGCGG + Intronic
1172092942 20:32446541-32446563 GGCAGCGGGGTGTGAGGGCAAGG + Exonic
1172143914 20:32743277-32743299 GGCGGCGGGGCGTGGGGCGCGGG - Intronic
1172274937 20:33674276-33674298 TGCCGCGGGGTCTGGGGCTGGGG + Exonic
1172284644 20:33732143-33732165 GGCCGCGGGGCGGAGGGCGCCGG + Intronic
1172693631 20:36807133-36807155 GGCAGCAGGGTGTGGGCCTATGG + Intronic
1172952058 20:38728680-38728702 GGGGGCGGGGTGAGGGGAGAAGG - Exonic
1173523840 20:43717401-43717423 GGCTGCGGGGTGCGGGGTGCAGG - Intergenic
1173585241 20:44177252-44177274 GAGGGTGGGGTGTGGGGCGAGGG - Intronic
1173836704 20:46130603-46130625 GGCTGGAGGGTGTGGGGCGATGG + Intergenic
1174252585 20:49230754-49230776 GGGGGCGGGGTGGGGGGAGAGGG - Intronic
1174576731 20:51542517-51542539 GGCTGCGGGGCCGGGGGCGAGGG + Exonic
1175215251 20:57389190-57389212 GGCCCGGGGGCGGGGGGCGAAGG + Intergenic
1175256989 20:57653439-57653461 GGCCCAGGGGAGTGGGGCCAGGG - Intronic
1175844809 20:62052743-62052765 GGACCCGGGGTGTGGGGTGTGGG - Intronic
1175944309 20:62551572-62551594 GGCGGCGAGGTGGGGGGCGGGGG + Intronic
1175966592 20:62662834-62662856 GGTCCCGGCGTGTGGGGGGATGG - Intronic
1176016714 20:62937743-62937765 GGCCGCACGGGGTGGGGCGGGGG - Intronic
1176124556 20:63469697-63469719 GGCAGCCGGGAGTGGGGGGAAGG - Intronic
1176135632 20:63520928-63520950 GCCCGAGGGGCGGGGGGCGAGGG + Intronic
1176219247 20:63962241-63962263 GGCAGCCGGGTGGGGGGCGTGGG - Intronic
1176221159 20:63969863-63969885 GGGCGCGGGGCGCGGGGCGCTGG + Intronic
1176247160 20:64102718-64102740 CACCGCGGGGTGGGGGGCGGAGG - Intergenic
1176297020 21:5079211-5079233 GGGCATGGGGTGTGGGGCGTGGG - Intergenic
1176553105 21:8238652-8238674 GGACGTGGGGCGTGGGGCGTGGG - Intergenic
1176572027 21:8421676-8421698 GGACGTGGGGCGTGGGGCGTGGG - Intergenic
1176579936 21:8466259-8466281 GGACGTGGGGCGTGGGGCGTGGG - Intergenic
1178319016 21:31590826-31590848 GGCCAAGGGGTGGGGGGCGGGGG + Intergenic
1178536052 21:33411319-33411341 GGCTCCGGGGTGGGTGGCGAGGG - Intronic
1179631234 21:42679957-42679979 GGCCGATGGGTGTGGGGAGCAGG + Intronic
1179783817 21:43718832-43718854 GGGCGCGGGGCGCGGGGCGCGGG + Intergenic
1179783819 21:43718839-43718861 GGGCGCGGGGCGCGGGGCGCAGG + Intergenic
1179860008 21:44182736-44182758 GGGCATGGGGTGTGGGGCGTGGG + Intergenic
1180801591 22:18634490-18634512 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1180852834 22:19030029-19030051 GGCCGCGGGGCGCGGCGCGGGGG - Intergenic
1181031182 22:20149508-20149530 GGCCACGGAGGGCGGGGCGAGGG - Intronic
1181220131 22:21360771-21360793 GGCCGCGGGGCGTGGCGCGGGGG + Intergenic
1183055156 22:35300478-35300500 GGCCGCGGGCTGTCCGGCGCTGG - Intronic
1183268919 22:36848869-36848891 GGCGGGGGGGTGGGGGGCGGGGG - Intergenic
1183359353 22:37375541-37375563 GGCCTCGGAGTGAGGGGCCAGGG + Exonic
1183630589 22:39030220-39030242 GGCGGCAGGGTGAGGAGCGAGGG - Intronic
1183634045 22:39050312-39050334 GGCGGCAGGGTGAGGAGCGAGGG - Intronic
1183748994 22:39708644-39708666 GGATCCGGGGTGTGGGGCGGAGG - Intergenic
1184245671 22:43234699-43234721 GGCTGCCTGGTGTGGGGCGGTGG - Intronic
1184711366 22:46251041-46251063 GCCCGCGGCGGCTGGGGCGAGGG - Intergenic
1184986908 22:48141900-48141922 GGACACGGGGTGGGGGGCGGGGG + Intergenic
1185228467 22:49667415-49667437 GGTGGAGGGGTGTGGGGGGAGGG - Intergenic
1185272391 22:49935333-49935355 GGGCGCGGGGTGGGGCGCGGGGG + Intergenic
1185272607 22:49935868-49935890 GGGTGCGGGGTGTGGGGCCTGGG + Intergenic
1185272767 22:49936348-49936370 GGGCGGGGGGTGTGCGGCGGCGG - Intergenic
1185283097 22:49983983-49984005 GGCTGCGGGGAGGGGGGGGAGGG - Intergenic
1185291547 22:50030211-50030233 GGTCTCGGGGTGGGGGGCGTGGG - Intronic
1185342899 22:50299600-50299622 TGCCGCGGGGCGTGGGGCTGGGG + Intronic
1185374196 22:50474683-50474705 GGCCGGGGGCTGGGGGCCGAGGG - Intronic
1203258103 22_KI270733v1_random:155694-155716 GGACGTGGGGCGTGGGGCGTGGG - Intergenic
949540238 3:5026743-5026765 CAGCGCGGGGTGTGGGGGGAGGG + Intergenic
951080491 3:18445346-18445368 GGCCGGGGTGTGGGGGGCGGCGG + Intronic
951536221 3:23743541-23743563 GGCGGCGGGGGGTGGGGCCGTGG - Intergenic
952211424 3:31232380-31232402 GGCCGTGAGGGGTGGGGTGAGGG - Intergenic
952451704 3:33439861-33439883 GGCCGCGGTGTGCGGGGCGACGG - Exonic
953561388 3:43995847-43995869 GGCCGCGGGGGAGGGGGCGAAGG + Intergenic
953618154 3:44510515-44510537 GGGCGCGGGGTGCGGAGCGGGGG - Intronic
953688208 3:45094705-45094727 GGGTGTGGGGTGTGGGGGGATGG + Intronic
953982096 3:47418069-47418091 GGCGGCGGGGGGTGGGGTGAGGG + Intronic
954375814 3:50193684-50193706 GGGCGCGGGGCGCGGGGCGCAGG + Intronic
954392619 3:50275479-50275501 GGCCGCCGGGAGGGAGGCGAAGG + Intronic
954714183 3:52518926-52518948 GGCCGTGGGGCCTGGGGCAATGG - Intronic
955182209 3:56683047-56683069 GGTCGACGGGTGTGGGGGGAAGG + Intronic
956379976 3:68654881-68654903 GGCGGGGGGGTGGGGGGGGAGGG + Intergenic
956497115 3:69839884-69839906 GGAGGAGGGGTGTGGGGGGAGGG - Intronic
957686425 3:83507986-83508008 GGGGGCGGGGTTTGGGGAGATGG + Intergenic
960223982 3:115147968-115147990 GGCTGCGGGGTGAGGGGCAGCGG + Intergenic
960638961 3:119809535-119809557 GGCGGCGGGGGGTGGGGGGAAGG + Intronic
963028373 3:140942171-140942193 GGCCGAGGGGGGTGGGGGGGTGG + Intronic
963078310 3:141368290-141368312 GGCGGCTGGGGGTGGGGAGACGG + Intronic
966182150 3:177197349-177197371 CGCCGCGGGGGGAGGGGCGGGGG + Intronic
966435144 3:179875536-179875558 GGTGGCGGGGAGTGGGGTGAGGG + Intronic
966441707 3:179952402-179952424 GGTCGGGGGGTGTGGGAAGAAGG + Intronic
966577455 3:181518613-181518635 GGCCCTGGGGTGTGGTGGGATGG - Intergenic
966595783 3:181723786-181723808 GGCGGCTGGCTGTGGGTCGAGGG - Intergenic
966764505 3:183447803-183447825 GGGCGCGGGGTGGGTGGTGAAGG + Intergenic
967067904 3:185937347-185937369 GGCCGCGTGGTGGGGTGCAAGGG - Intronic
967316196 3:188154045-188154067 GGGCGCGGGGCGTGGGGCGCTGG + Intronic
967732327 3:192917884-192917906 GGGGGCGGGGTGGGGGGCGGGGG - Exonic
967904020 3:194486550-194486572 GGCCCCGGTGAGCGGGGCGAGGG - Intronic
968085920 3:195873828-195873850 GGGCGCGGGGCGCGGGGAGACGG + Intronic
968491077 4:890808-890830 GGCCGCGGGGTGAGGGGATGAGG - Intronic
968556404 4:1248381-1248403 GGCCGCGCGCTGTGGGGGAAGGG - Intronic
968649198 4:1753713-1753735 GGGGGCCAGGTGTGGGGCGAGGG + Intergenic
968653125 4:1767750-1767772 GGGCGCGGGGCGCGGGGCGGGGG - Intergenic
969240248 4:5892615-5892637 GGTCGCGGGGCGCGGGGCGGCGG + Exonic
969294038 4:6258813-6258835 GGCCCAGAGGTGTGGGGAGAAGG + Intergenic
969594479 4:8141185-8141207 GGCTCCGGGGGGTGGGGAGAGGG - Intronic
969636193 4:8370586-8370608 GGCCGGGGGGAGTGGGAGGAGGG + Intronic
970093655 4:12437493-12437515 GGGAGCGGGGTGGGGGGCGGGGG + Intergenic
971253486 4:24992792-24992814 GGCAGTGGGGTGAGGGGTGAGGG - Intergenic
972396791 4:38664553-38664575 GGCCGCGGGGAATGGGTCGGGGG + Intronic
972770976 4:42196851-42196873 GGGGGCGGGGGGTGGGGAGACGG - Intergenic
973179657 4:47252075-47252097 GGCAGCGGGGTGGGGGGCGGTGG - Intronic
973306183 4:48653406-48653428 GGGGGCGGGGTGTGGGACGGGGG - Intronic
974716023 4:65669707-65669729 GGCCCCGGGGTGCGGGACGCCGG - Exonic
975661111 4:76689681-76689703 GGCCGCGAGGCGAGCGGCGATGG + Intronic
976356195 4:84120288-84120310 TGTCGAGGGGTGTGGGGCTAGGG + Intergenic
978620462 4:110631402-110631424 GGCCGAGGGCTGTGGGGGGGGGG + Intronic
978857961 4:113414584-113414606 GGCAGCTTGGTGTGGGCCGATGG + Intergenic
980354549 4:131724936-131724958 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980355080 4:131727442-131727464 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980356703 4:131734908-131734930 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980357242 4:131737396-131737418 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980357785 4:131739891-131739913 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980359395 4:131747344-131747366 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980359938 4:131749812-131749834 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980360477 4:131752307-131752329 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980361560 4:131757262-131757284 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980362644 4:131762217-131762239 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
980378094 4:131976292-131976314 GGCTGCGGGGACTGGGGCGGCGG + Intergenic
982770195 4:159390262-159390284 GGCCACGGGGTGGGGGGTGGGGG - Intergenic
983537870 4:168877817-168877839 GGCGGCGGGAAGGGGGGCGAGGG - Intronic
983792348 4:171813435-171813457 GGCGCCGGGGAGTGGGGCGCGGG + Intronic
984641910 4:182175907-182175929 GGCGGCAGGGTGGGGGGCGGGGG - Intronic
984778545 4:183504739-183504761 GGCCGCGGGCGGAGGGGCGGGGG + Intergenic
985531042 5:434015-434037 AGCCGCGGGGCATGGGGCGCAGG - Exonic
986347173 5:6846200-6846222 GGCCTCGGGGCTTGGGGGGAGGG - Intergenic
986710630 5:10485857-10485879 GGTCGCGGGGTGGGGGGGGGGGG + Intergenic
992668072 5:79031101-79031123 GGCAGCGGGGAGTGGGACTATGG + Intronic
994831449 5:104788039-104788061 GGCGGTGGGGGGTGGGGCGGGGG + Intergenic
995081342 5:108054106-108054128 TGTTGCGGGGTGTGGGGAGAGGG + Intronic
995183950 5:109252696-109252718 GGCCCAGGGCTGTGGGGTGAAGG - Intergenic
995219589 5:109633040-109633062 TGTCGGGGGGTGTGGGGCTAGGG - Intergenic
995317114 5:110788025-110788047 TGTCGCAGGGTGTGGGGCTAGGG - Intergenic
996182630 5:120438195-120438217 TGTCGCGGGGTGGGGGGCAAGGG + Intergenic
996717764 5:126601257-126601279 GGCCGAGGGGCGAGGGGCGACGG + Intronic
997584093 5:135034444-135034466 GGCCGCGGGGGGCGGGGAGGCGG - Intronic
998059907 5:139111832-139111854 GACCGTGGGGAGTGGGGAGAGGG - Intronic
998130354 5:139648618-139648640 GGCCGCGGGGAGGGGGAGGAGGG + Exonic
998139722 5:139693050-139693072 GGCCGCAGGGTCAGGGGTGAGGG - Intergenic
998386775 5:141761772-141761794 GGCAGCTGGGTGTGGGGAGCTGG + Intergenic
998390049 5:141781564-141781586 GGCTGCAGGGAGTTGGGCGACGG - Intergenic
1001640325 5:173239274-173239296 GGCTGCGGGGTGGGGGGTGATGG - Intergenic
1001678666 5:173539505-173539527 TGCCGGGGGGTGGGGGGCAAGGG + Intergenic
1001801250 5:174546072-174546094 GGAGGTGGGGTGTGGGGCGATGG - Intergenic
1001816449 5:174673227-174673249 GGCCGCGGGGAGGGGGGCAGAGG - Intergenic
1001984476 5:176061603-176061625 TGGGGCTGGGTGTGGGGCGAGGG + Intronic
1002204715 5:177554477-177554499 GGCGGCGGCGTGTGGAGCGAGGG - Exonic
1002233038 5:177782594-177782616 TGGGGCTGGGTGTGGGGCGAGGG - Intronic
1002262953 5:178007225-178007247 TGGGGCTGGGTGTGGGGCGAGGG + Intronic
1002368457 5:178730674-178730696 CGCCGCGGGGTGAGCGGCGCCGG - Exonic
1002559891 5:180073862-180073884 GGCCCTGGGCTGTGGGGAGAAGG - Intergenic
1002646513 5:180659188-180659210 GGACGCGGGGTGGGGGGTGGCGG - Intergenic
1002841832 6:913107-913129 GGGCGCGGGGGGTGGGGAGCGGG - Intergenic
1002954138 6:1845648-1845670 GGACTGGGGGTGTGGGGCGATGG + Intronic
1003494747 6:6654090-6654112 GGCTGCAGGGAGTGGGGGGATGG - Intronic
1004607255 6:17206387-17206409 GGCCGCGGGGGGAGGGGAGCAGG + Intergenic
1005512152 6:26520915-26520937 GGCTGCGGCGGGTGGGGCGGCGG - Intergenic
1005825208 6:29628091-29628113 GGCAGCGGGGGGTGGGGGGGCGG + Intronic
1005987704 6:30884632-30884654 GGCGGCGGGGCGAGGGGCGGGGG - Intronic
1006247614 6:32753298-32753320 GGGGGTGGGGTGTGGGGAGAGGG + Intergenic
1006296022 6:33170476-33170498 GGCAGTGGGGTGTGGGGTGGGGG + Intronic
1006320689 6:33317675-33317697 GGCCGCCGAGTGAGGGGCGGGGG - Exonic
1006336034 6:33420857-33420879 GGCAGTGGGGGGTGGGGGGATGG + Intronic
1006505311 6:34485466-34485488 GTCAGCGGGGTGTGGGGTGAGGG + Intronic
1006512128 6:34527176-34527198 CGCCGCGGGGCGGGGGGCGGGGG + Intronic
1006759004 6:36442975-36442997 GGCCGCGCGGTCCGGGGCGGGGG + Exonic
1007363247 6:41373294-41373316 GACTGCGGGGTCAGGGGCGAAGG - Intergenic
1014671336 6:124308137-124308159 TGCTGCGGGGTGGGGGGCAAAGG - Intronic
1015670046 6:135678329-135678351 GTCAGTGGGGTGTGGGGCTAAGG - Intergenic
1018020911 6:159761870-159761892 GGGCGCGGGGCGCGGGGCGCGGG - Exonic
1018778996 6:167045351-167045373 GGCCGCGGGGGGGGCGGGGAGGG - Exonic
1018990249 6:168668952-168668974 GGACGCGGGGTGTGGGGGAGGGG - Intronic
1018990357 6:168669200-168669222 GGACGCGGGGTGTGGGGGACGGG - Intronic
1019404639 7:877095-877117 GGCCGAGGGGCGTGTGGGGACGG - Intronic
1019479657 7:1260601-1260623 GGCCGCGGGGAGAGGGGAGGTGG - Intergenic
1019609727 7:1930448-1930470 GGCAGTGGGGGATGGGGCGAGGG - Intronic
1019609738 7:1930476-1930498 GGCAGTGGGGGATGGGGCGAGGG - Intronic
1019775421 7:2909550-2909572 GGCTGAGGGGTGAGGGGCGCAGG - Intronic
1020111952 7:5452360-5452382 GACTGCGGGGTGTGGGGCCAGGG - Intronic
1020224890 7:6272405-6272427 GGCCGGGGGCTGGGGGTCGAGGG - Intronic
1021510486 7:21427942-21427964 GGCCGAGGGGGGTGGGGAGTCGG + Intergenic
1023638595 7:42237134-42237156 GGCCGCGGGGCGCGCGGGGAAGG + Intronic
1025142751 7:56479290-56479312 GGTCCTGGGGTGTGGGGTGAAGG + Intergenic
1025708805 7:63889890-63889912 GGTCCTGGGGTGTGGGGTGAAGG + Intergenic
1026227169 7:68452643-68452665 GGCTGGGGGGTGTGGGGCGGCGG + Intergenic
1026909525 7:74084053-74084075 GGCCGCGGGGTGTGGGGCGAGGG + Intronic
1026970689 7:74465733-74465755 GTCCGTGGGGTGTGGGGTGTGGG + Intronic
1027212811 7:76164533-76164555 GGCCGCGGGGGGACGGGGGAGGG + Intergenic
1030600155 7:111583398-111583420 GGGGGCGGGGTGGGGGGCGGGGG + Intergenic
1033220502 7:139523974-139523996 GGGCGCGGGGCGCGCGGCGAGGG - Exonic
1034291377 7:149934760-149934782 GGCAGCGTGGTGTGGGGCAGAGG - Intergenic
1034475660 7:151280123-151280145 GGCTATGGGGTGTGGGGCCAGGG - Intergenic
1034567795 7:151929406-151929428 GGCCCCGGAGCTTGGGGCGAGGG + Intergenic
1034814721 7:154162134-154162156 GGCAGCGTGGTGTGGGGCAGAGG + Intronic
1035116493 7:156528808-156528830 GGTCGTGGGGTGTGGGGAGGGGG + Intergenic
1035260638 7:157659382-157659404 GGCCGCGGGGATGGGGGGGATGG + Intronic
1035373868 7:158395288-158395310 GGGTGAGGGGTGAGGGGCGAGGG + Intronic
1035373874 7:158395302-158395324 GGGCGAGGGGTGAGGGGCGAGGG + Intronic
1035373920 7:158395413-158395435 GGGTGAGGGGTGAGGGGCGAGGG + Intronic
1035373924 7:158395427-158395449 GGGCGAGGGGTGAGGCGCGAGGG + Intronic
1035373937 7:158395455-158395477 GGGCGAGGGGCGAGGGGCGAGGG + Intronic
1035373950 7:158395483-158395505 GGGCGAGGGGTGCGGGGCGAGGG + Intronic
1035374031 7:158395693-158395715 GGGCGAGGGGCGAGGGGCGAGGG + Intronic
1035374048 7:158395742-158395764 GGGCGAGGGGTGAGGCGCGAGGG + Intronic
1035374055 7:158395763-158395785 GGGCGAGGGGTGAGGCGCGAGGG + Intronic
1035374062 7:158395784-158395806 GGGCGAGGGGTGAGGCGCGAGGG + Intronic
1036798051 8:11769955-11769977 TGCCTCGGGGTGCGGGGAGAGGG - Exonic
1037520985 8:19680554-19680576 GGGGGGGGGGGGTGGGGCGAGGG - Intronic
1038540342 8:28385856-28385878 GGCCGCGGCGGGCGGGGCGCGGG - Intronic
1039608601 8:38901725-38901747 GGCTGCGGGGGGTGGGGCCGCGG + Intronic
1039676461 8:39673458-39673480 GGGGGTGGGGTGTGGGGAGAGGG - Intronic
1040312647 8:46244660-46244682 GGCCGCAGGGTGTGGTGAGCGGG + Intergenic
1040471432 8:47738249-47738271 GGCCGCGGGGGAAGGGGCGGGGG + Exonic
1041690036 8:60679206-60679228 GGGCGAGGGGCGAGGGGCGAGGG + Intronic
1042020817 8:64370280-64370302 GGGCGTGGGGCGAGGGGCGAGGG + Intergenic
1042020820 8:64370287-64370309 GGGCGAGGGGCGAGGGGCGAGGG + Intergenic
1042082615 8:65071548-65071570 GGGCGCGGGGGGCGGGGGGAGGG + Intergenic
1042090055 8:65149223-65149245 TGTCGCGGGGTGGGGGGCTAGGG - Intergenic
1042591570 8:70402976-70402998 GCCCCGGGGGTGGGGGGCGAGGG - Intronic
1043036125 8:75202467-75202489 TGTCGTGGGGTGTGGGGCAAGGG - Intergenic
1043382134 8:79714026-79714048 TGTCGGGGGGTGTGGGGCTAGGG + Intergenic
1044335986 8:90985251-90985273 GGGCGAGGGGCGGGGGGCGAGGG + Exonic
1044719670 8:95133661-95133683 GGGCGCGAGGGGCGGGGCGAGGG + Intergenic
1045871095 8:106927865-106927887 TGCCGTGGGGTGGGGGGCAAGGG - Intergenic
1046754862 8:117962746-117962768 GGGTGGGGGGTGTGGGGGGATGG - Intronic
1047631239 8:126710952-126710974 TGTCGGGGGGTGTGGGGCTAGGG + Intergenic
1049291099 8:141802366-141802388 GCTGGCGGGGTGTGGGGGGAGGG + Intergenic
1049363368 8:142224874-142224896 GCCCGCGGGGAGTGGGGCAGAGG + Intronic
1049588435 8:143442397-143442419 GGCCGGGGGGGGTGGGGGGGCGG + Intronic
1049707365 8:144049146-144049168 GGCCGCGGGGCGTCGGTCGCCGG - Intergenic
1049789589 8:144466597-144466619 GGGCACGGGGCGCGGGGCGACGG + Intronic
1049884383 9:17679-17701 GGCCGAGGGGTGTGGGCGGGAGG - Intergenic
1050166580 9:2770642-2770664 GGCTGCGGGGGGTGGAGGGAGGG + Intronic
1051079553 9:13279222-13279244 GGCGGCGGGCCGTGGGGCGGTGG - Intronic
1051418731 9:16870518-16870540 GCCCGCGGCGTGAGGGGCAAGGG - Intronic
1051459395 9:17294908-17294930 GGCGGGGGGGAGTGGGGGGAGGG + Intronic
1051665637 9:19464956-19464978 GGGCGCGGGGCGCGGGGCGCAGG + Intergenic
1052888822 9:33676948-33676970 GGCCACGGGGGGTGCGGCGGCGG + Intergenic
1053001231 9:34578180-34578202 GGCCGCGCGGTGAGCGACGAGGG + Intronic
1053643115 9:40106727-40106749 GGCTGCGGGGACTGGGGCGGCGG + Intergenic
1054323967 9:63703955-63703977 GGCTGCGGGGACTGGGGCGGCGG + Intergenic
1054541640 9:66269876-66269898 GGCTGCGGGGACTGGGGCGGCGG - Intergenic
1055265994 9:74497173-74497195 GGAGGCGGGGGGTGGGGCGGGGG - Intergenic
1056769231 9:89464816-89464838 TACCACGGGGTGTGGGGGGAGGG + Intronic
1057047590 9:91898049-91898071 GGCCCAGGGGTGTGGCCCGAGGG - Intronic
1057490634 9:95517034-95517056 GGCCGCGGGGGGCGGGGAGAGGG - Intronic
1058045439 9:100352688-100352710 GGCCGCGGATCGGGGGGCGACGG + Intronic
1058236836 9:102500416-102500438 GGCCGAGGGGTGGGGGGGGGGGG + Intergenic
1059398668 9:114054930-114054952 GGCGGGGGGGTGGGGGGGGAAGG - Exonic
1060478124 9:124000172-124000194 GGCCGGGGGGCGGGGGGCGGGGG - Intergenic
1060917088 9:127397829-127397851 GCCCGCGGGGAGTGGGTGGAGGG + Intronic
1061000433 9:127899456-127899478 GGCCGCGGGGGCGGGGGCGGAGG - Intronic
1061423441 9:130484435-130484457 TGCAGCGGGGAGTGGGGAGACGG - Intronic
1061840517 9:133356361-133356383 GGGTGCGGGGTGCGGGGCGCGGG - Intronic
1061881573 9:133571697-133571719 GGCGGCTGGGTCTGGGGCCAGGG - Intronic
1061967751 9:134025613-134025635 GCGCGCGGGGTCTGGGGCGCGGG + Intergenic
1062072617 9:134565683-134565705 GGCTGCGGGGTAGCGGGCGATGG + Intergenic
1062230480 9:135479510-135479532 CTCCGCGGGGTGCGGGGCGAAGG - Intronic
1062435760 9:136545995-136546017 GGGCGCGGGGCGCGGGGCGCGGG - Intergenic
1062556348 9:137114858-137114880 GGCCGCGGGGCGCGGGGTGTTGG - Intronic
1203474297 Un_GL000220v1:137717-137739 GGACGTGGGGCGTGGGGCGTGGG - Intergenic
1187238323 X:17488937-17488959 TGTCGAGGGGTGTGGGGCTAGGG - Intronic
1188363966 X:29291551-29291573 TGTCGGGGGGTGTGGGGCTAGGG - Intronic
1190008002 X:46758661-46758683 GGCCGAGGGGTGTGGAGGGCGGG + Intronic
1190011214 X:46786671-46786693 GGCAGCGGGGGGTGGGGCAAGGG - Intergenic
1190526543 X:51333754-51333776 GGGGGGGGGGTGGGGGGCGAGGG + Intronic
1191811652 X:65196118-65196140 AGCTGCGGGGGGTGGGGGGAAGG - Intergenic
1191955515 X:66639095-66639117 GGGCGCGGGGTGAAGGGCGGGGG - Intronic
1192057319 X:67785943-67785965 GGCCGGGGGGGGAGGGGCGGGGG + Intergenic
1192491060 X:71578000-71578022 GGGCGCGGGGGGAGGGGCGGGGG - Intergenic
1195306070 X:103585462-103585484 GGAGGCGGGGCGTGGGGCGGTGG + Intronic
1195695368 X:107663098-107663120 GGCCGGGGGGTGGGGGGTGGGGG - Intergenic
1195768855 X:108327305-108327327 GGGTGGGAGGTGTGGGGCGAGGG - Intronic
1196425167 X:115561988-115562010 GGACAGGGGGTGTGGGGCCAGGG - Intronic
1198148868 X:133888069-133888091 TGTCGTGGGGTGTGGGGCTAGGG - Intronic
1198388186 X:136147832-136147854 GGCTGCGGGGTGCGGGACGAGGG + Intronic
1200100775 X:153688398-153688420 GGCGGCGGGGTGCGGGGCGCGGG - Exonic
1200213470 X:154357090-154357112 GGCCGTGGGCTGGAGGGCGAGGG - Intronic
1200281575 X:154781332-154781354 GGCGGCGGGGAGGGGGGGGAAGG + Intronic
1200323819 X:155216806-155216828 GGACGAGGGGCGAGGGGCGAGGG + Intronic
1200401422 X:156022477-156022499 GGCCGAGGGGTGTGGGCGGGAGG + Intergenic
1201140462 Y:11023275-11023297 GGCGGGGGGGTGGGGGGGGAGGG - Intergenic
1201286266 Y:12381368-12381390 GGGGGCGGGGGGTGGGGCGGTGG - Intergenic